GEO Profiles Links for Nucleotide (Select 924182050) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 297

<< First< Prev

Page of 15

Next >Last >>

Select item 996539151.

Igsf8 - Lipopolysaccharide-stimulated, NFκB ζ inhibitor (IκBζ) deficient-peritoneal macrophages

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL6246, 10351769 (ID_REF), GDS4578, NM_080419, AF411055, AF439263, BC048387, AK048270, chr1:172261641-172319841 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 99653915

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 978529062.

Igsf8 - Atherosclerosis susceptibility model: macrophages

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL9734, 100090119_TGI_at (ID_REF), GDS4527, NM_080419

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97852906

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74695243.

Igsf8 - MPSS transcriptome analysis project

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGTAGCACCCCAGTTC (ID_REF), GDS868, NM_080419

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7469524

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 643407064.

Igsf8 - Hypertension model: aorta

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL9734, 100090119_TGI_at (ID_REF), GDS3672, NM_080419

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64340706

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 650391495.

Igsf8 - Lean B6.C-D7Mit353 strain: various tissues

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL2995, 645059 (ID_REF), GDS3692, NM_080419

DataSet type:: Expression profiling by array, count, 25 samples

ID:: 65039149

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303801506.

Igsf8 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL4134, 35150 (ID_REF), GDS5664, NM_080419, A_51_P442788 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130380150

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 546446387.

Igsf8 - Skin carcinogenesis model

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL4234, 1580592 (ID_REF), GDS3334, NM_080419

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 54644638

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1323132168.

Igsf8 - Transcription factor engrailed-2 loss-of-function model of autism spectrum disorder: hippocampus

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P442788 (ID_REF), GDS6016, NM_080419, A_51_P442788 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 132313216

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 460029389.

Igsf8 - Histone deacetylase 5 deficient nucleus accumbens response to cocaine

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL4234, 1580592 (ID_REF), GDS2993, NM_080419

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 46002938

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11882671610.

Igsf8 - Transcription factor engrailed-2 loss-of-function model of autism spectrum disorder: cerebellum

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P442788 (ID_REF), GDS5241, NM_080419, A_51_P442788 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118826716

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9271731511.

Igsf8 - Zinc finger transcription factor Fezf1 deficiency effect on main olfactory epithelial cells

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL6246, 10351769 (ID_REF), GDS4446, NM_080419, AF411055, AF439263, BC048387, AK048270, chr1:172261641-172319841 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 92717315

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5023314912.

Igsf8 - Reversine effect on myoblast cell line

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL2995, 645059 (ID_REF), GDS3159, NM_080419

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 50233149

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12706835013.

Igsf8 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL4134, 35150 (ID_REF), GDS5461, NM_080419, A_51_P442788 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127068350

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9213845514.

Igsf8 - CD-1 neuronal stem cell response to microRNA-128 mimic

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL13455, NM_080419_at (ID_REF), GDS4415, NM_080419

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 92138455

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9681991515.

Igsf8 - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL6246, 10351769 (ID_REF), GDS4486, NM_080419, AF411055, AF439263, BC048387, AK048270, chr1:172261641-172319841 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96819915

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9713990616.

Igsf8 - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL9734, 100090119_TGI_at (ID_REF), GDS4495, NM_080419

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97139906

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13044391617.

Igsf8 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P442788 (ID_REF), GDS5666, NM_080419, A_51_P442788 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130443916

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12913561618.

Igsf8 - Citrobacter rodentium infection of interleukin-10 deficient colon

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P442788 (ID_REF), GDS5629, NM_080419, A_51_P442788 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129135616

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6802698419.

Igsf8 - Snord116del mutant hypothalamus response to neonatal starvation

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2699160 (ID_REF), GDS3786, NM_080419

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 68026984

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9741831520.

Igsf8 - Model for the manic pole of bipolar disorder: hippocampus

Annotation:: Igsf8, immunoglobulin superfamily, member 8

Organism:: Mus musculus

Reporter:: GPL6246, 10351769 (ID_REF), GDS4517, NM_080419, AF411055, AF439263, BC048387, AK048270, chr1:172261641-172319841 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 97418315

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 15

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 924182050) (297)
GEO Profiles
Profile neighbors for GEO Profiles (Select 74852840) (200)
GEO Profiles
Chromosome neighbors for GEO Profiles (Select 74292566) (20)
GEO Profiles
Homologene neighbors for GEO Profiles (Select 62313667) (0)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 297

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity