GEO Profiles Links for Nucleotide (Select 255683352) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 302

<< First< Prev

Page of 16

Next >Last >>

Select item 441789001.

Dyx1c1 - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL891, 13200 (ID_REF), GDS2924, NM_026314, A_51_P332264 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44178900

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 129971002.

Dyx1c1 - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL891, 13200 (ID_REF), GDS1359, NM_026314, A_51_P332264 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 12997100

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 728287563.

Dyx1c1 - Spatial and temporal development of mammalian salivary glands

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P332264 (ID_REF), GDS3922, NM_026314, A_51_P332264 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72828756

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 249586004.

Dyx1c1 - Estren effect on the estrogen receptor alpha null uterus: time course

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL891, 13200 (ID_REF), GDS2078, NM_026314, A_51_P332264 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 24958600

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 529486245.

Dyx1c1 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL2872, 2224 (ID_REF), GDS3259, NM_026314, A_51_P332264 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52948624

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 63358006.

Dyx1c1 - Typical and atypical antipsychotic drugs effect on brain

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL891, 13200 (ID_REF), GDS775, NM_026314, A_51_P332264 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 4 samples

ID:: 6335800

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 553573257.

Dyx1c1 - Transcription factor STAT5b deficiency effect on the colon

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL5759, NM_026314_at (ID_REF), GDS3385, NM_026314

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 55357325

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75079938.

Dyx1c1 - MPSS transcriptome analysis project

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCAGTACCGGGAAGGC (ID_REF), GDS868, NM_026314

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7507993

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1226615569.

Dyx1c1 - T helper type 9 cells stimulated with anti-CD3 antibody

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P332264 (ID_REF), GDS5343, NM_026314, A_51_P332264 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 122661556

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7571857310.

Dyx1c1 - Cyclophosphamide effect on peripheral blood leukocytes: time course

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL13209, 025E05 (ID_REF), GDS4004, NM_026314

DataSet type:: Expression profiling by array, log2 ratio, 30 samples

ID:: 75718573

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2493530011.

Dyx1c1 - Estren effect on the uterus: time course

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL891, 13200 (ID_REF), GDS2077, NM_026314, A_51_P332264 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 12 samples

ID:: 24935300

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13043885612.

Dyx1c1 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P332264 (ID_REF), GDS5666, NM_026314, A_51_P332264 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130438856

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1302040013.

Dyx1c1 - Conjugated linoleic acid delipidative effect on obese line: time course

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL891, 13200 (ID_REF), GDS1360, NM_026314, A_51_P332264 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13020400

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1769860014.

Dyx1c1 - Werner syndrome protein and poly(ADP-ribose) polymerase-1 null mutants

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL891, 13200 (ID_REF), GDS1675, NM_026314, A_51_P332264 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 17698600

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10917648715.

Dyx1c1 - Secreted frizzled-related protein 5 mutation effect on gonadal white adipose tissue

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL6246, 10587000 (ID_REF), GDS4988, NM_026314, XM_006511382, AY428507, AY464142, BC026462, NM_001163725, XM_006511381, chr9:72958785-72973064 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 109176487

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2796760016.

Dyx1c1 - Estradiol effect on the uterus: time course

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL891, 13200 (ID_REF), GDS2208, NM_026314, A_51_P332264 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 27967600

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7570467317.

Dyx1c1 - Cyclophosphamide effect on bone marrow: time course

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL13209, 025E05 (ID_REF), GDS4003, NM_026314

DataSet type:: Expression profiling by array, log2 ratio, 40 samples

ID:: 75704673

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8963228718.

Dyx1c1 - Lung epithelium response to fungal allergen Alternaria

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL6246, 10587000 (ID_REF), GDS4423, NM_026314, XM_006511382, AY428507, AY464142, BC026462, NM_001163725, XM_006511381, chr9:72958785-72973064 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 89632287

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3018100319.

Dyx1c1 - High and low weight gainers: hypothalamus

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL2995, 339175 (ID_REF), GDS2320, NM_026314

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 30181003

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 7505625620.

Dyx1c1 - High-fat dietary restriction effect on epididymal white adipose tissue

Annotation:: Dyx1c1, dyslexia susceptibility 1 candidate 1

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P332264 (ID_REF), GDS3986, NM_026314, A_51_P332264 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 75056256

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 16

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 255683352) (302)
GEO Profiles
PREDICTED: Mus musculus snail family zinc finger 3 (Snai3), transcript variant X...
PREDICTED: Mus musculus snail family zinc finger 3 (Snai3), transcript variant X1, mRNA
gi|1907189662|ref|XM_006531074.5|

Nucleotide
RefSeq RNA Links for Gene (Select 81602) (15)
Nucleotide
Mus musculus strain:129X1/SvJ; 129S1/SvImJ; DBA/2J; A/J
Mus musculus strain:129X1/SvJ; 129S1/SvImJ; DBA/2J; A/J
Celera Genomics used whole genome shotgun sequencing to sequence the mouse genome

BioProject
BioProject Links for Protein (Select 148701507) (1)
BioProject

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 302

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity