 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 18, 2019 |
| Title |
cyto polyA RNAseq rep2 |
| Sample type |
SRA |
| |
|
| Source name |
cyto polyA RNAseq
|
| Organism |
Rattus norvegicus |
| Characteristics |
tissue source: Embryonic day 19 rat hippocampus
cell type: Primary hippocampal neurons
days in vitro: 14
cell culture platform: Standard 6 cm culture dish
cellular fraction: Cytoplasm
molecule subtype: polyA RNA
|
| Growth protocol |
Hippocampal neurons were extracted from embryos of pregnant rats at 19 days of gestation and maintained in culture for 14 days. To separate projections from cell bodies, neurons were cultured on poly-L-lysine coated semipermeable membranes with 1 μm holes. For cytoplasmic fractionation, neurons were cultured on 6-cm poly-L-lysine coated, standard tissue culture plates. Cells were maintained in Neurobasal media (Invitrogen 21102-049), supplemented with glutamax (Gibco™ 35050061), antibiotic/antimycotic (Gibco™ 15240062), and B27 (Gibco™ 17504001). On day three, Cytosine beta-D-arabinofuranoside (Sigma-Aldrich #C1768), a DNA replication inhibitor, was added to the media to inhibit glial cell division. On day six and day twelve of neuron culture, half of the Neurobasal media was replaced with fresh media. On day 14, cells were harvested for sequencing library preparation.
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Library preparation method: Heyer E.E., … Moore M.J. (Nucleic Acids Res., 2015)
Cyclohexamide was added to the media to inhibit translation and stall ribosomes. The plates were placed on ice, media was removed and the cells were rinsed with ice-cold PBS (containing cyclohexamide). Cells were lysed using lysis buffer (10 mM Tris-HCl pH 7.5, 5 mM MgCl2, 100 mM KCl, 1% Triton™ X-100, 2 mM DTT, 100 μg/ml cycloheximide, protease inhibitor (Complete, EDTA-free, Roche)) and centrifuged to pellet the nuclei. The supernatant was recovered to prepare ribosome profiling and polyA+ RNA-seq libraries. To purify ribosome occupied RNA, the lysate was treated with RNase T1 (Fermentas) and RNase A (Ambion) to break down polysomes into monosomes, followed by density gradient ultracentrifugation. A gradient fractionator (Brandel) was used to identify and collect the monosome enriched fraction. RNA was subsequently isolated from the monosome enriched fraction for library preparation. Polyadenylated RNA from the cytoplasmic fraction was also sequenced. To extract RNA for ribosome profiling and polyA+ RNAseq, SDS and proteinase K was added to the lysate and samples were incubated at 42°C for 45 minutes. One volume of acid phenol/chlorofom (Ambion AM9720, pH 4.5) was added and the samples were vortexed for 30 seconds followed by centrifugation at 12,000 x g for 15 minutes. The supernatant was transferred to a clean microcentrifuge tube and 0.1 volume of sodium acetate (3 M, pH 5.2) and 10 mM final concentration of MgCl2 were added. To precipitate RNA, 1 volume of 100% isopropanol was added to the solution and centrifuged at 12,000 x g for 35 minutes. The precipitated RNA was rinsed with 70% ethanol, air dried, and reconstituted in water.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
Genome build: rnor6
Library strategy: Ribosome profiling
Reads in raw data were trimmed to remove a 7nt long barcode sequence from the 5'ends. The adapter was trimmed from each read and reads >= 24 nt were retained. Reads aligning completely to rRNA, tRNA, repeat elements (catalogued by RepeatMasker), and mitochondrial genome were removed prior to alignment to the rat genome using TopHat version 2.0.14: $ tophat -p 4 --library-type fr-secondstrand --b2-sensitive -g 10 --keep-tmp -G <genes.gtf> -o <output_directory> <genome_index_base> <filtered_reads.fastq>
The alignments are provided as bigwig files. They were prepared using bamCoverage from deepTools version 2.2.2: bamCoverage --binSize 10 -p 2 -b <input.bam> -o <output.bw>
Please note: If the insert is too small in polyA+ RNAseq or ribosome profiling raw data, then reads would be expected to contain the adaptor sequence "TGGAATTCTCGGGTGCCAAGG". We recommend removing the adaptor and any trailing sequence prior to genome alignment. One way to do so is by using the cutadapt program (Martin, 2011): $ cutadapt -a TGGAATTCTCGGGTGCCAAGG -o outputfile inputfile
|
| |
|
| Submission date |
Apr 16, 2019 |
| Last update date |
Apr 18, 2019 |
| Contact name |
Harleen Saini |
| E-mail(s) |
harleen_saini@hms.harvard.edu
|
| Organization name |
Harvard Medical School
|
| Lab |
Danesh Moazed
|
| Street address |
240 Longwood Avenue
|
| City |
Boston |
| State/province |
MA |
| ZIP/Postal code |
02115 |
| Country |
USA |
| |
|
| Platform ID |
GPL18694 |
| Series (1) |
| GSE129924 |
Free circular introns with an unusual branchpoint in neuronal projections |
|
| Relations |
| BioSample |
SAMN11444426 |
| SRA |
SRX5701019 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3728212_CytoRNAseq_rep2.bw |
21.6 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
