GEO Profiles Links for Nucleotide (Select 34536814) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 338

<< First< Prev

Page of 17

Next >Last >>

Select item 1291516101.

Ppp6r1 - Citrobacter rodentium infection of interleukin-10 deficient colon

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P463386 (ID_REF), GDS5629, NM_172894, A_52_P463386 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129151610

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74838292.

Ppp6r1 - MPSS transcriptome analysis project

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCATCCAGCCCTCCAG (ID_REF), GDS868, NM_172894

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7483829

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1270347793.

Ppp6r1 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL4134, 1579 (ID_REF), GDS5461, NM_172894, A_52_P463386 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127034779

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1222788794.

Ppp6r1 - Industrial pollution effect on liver

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus, Mus spretus

Reporter:: GPL4134, 1579 (ID_REF), GDS5331, NM_172894, A_52_P463386 (SPOT ID)

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 122278879

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1152992795.

Ppp6r1 - Glucocorticoid effect on the female liver

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL4134, 1579 (ID_REF), GDS5036, NM_172894, A_52_P463386 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115299279

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1152526796.

Ppp6r1 - Glucocorticoid effect on the male liver

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL4134, 1579 (ID_REF), GDS5035, NM_172894, A_52_P463386 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115252679

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 640623107.

Ppp6r1 - SIRT1 deficiency effect on the liver

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P463386 (ID_REF), GDS3666, NM_172894, A_52_P463386 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 64062310

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303465798.

Ppp6r1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL4134, 1579 (ID_REF), GDS5664, NM_172894, A_52_P463386 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130346579

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1143695939.

Ppp6r1 - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL6246, 10559610 (ID_REF), GDS4946, NM_172894, AK122450, BC053076, BC141039, chr7:4631495-4658950 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114369593

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4140735010.

Ppp6r1 - Nephronophthisis model

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL2897, 129014 (ID_REF), GDS2817, NM_172894, BG228256

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41407350

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12683349311.

Ppp6r1 - TGIF1-transduced MLL-AF9-transformed leukemic cells

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL6246, 10559610 (ID_REF), GDS5456, NM_172894, AK122450, BC053076, BC141039, chr7:4631495-4658950 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 126833493

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10006599312.

Ppp6r1 - APCΔ468 model of polyposis: regulatory T cells from various organs

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL6246, 10559610 (ID_REF), GDS4588, NM_172894, AK122450, BC053076, BC141039, chr7:4631495-4658950 (SPOT ID)

DataSet type:: Expression profiling by array, count, 44 samples

ID:: 100065993

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7511129313.

Ppp6r1 - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL6246, 10559610 (ID_REF), GDS3987, NM_172894, AK122450, BC053076, BC141039, chr7:4631495-4658950 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75111293

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5517387914.

Ppp6r1 - Iron enriched and deficient diets effect on the liver

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL4134, 1579 (ID_REF), GDS3373, NM_172894, A_52_P463386 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 55173879

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12995346615.

Ppp6r1 - DNA methyltransferase inhibitor 5-Aza-2’deoxycytidine effect on partially-ligated left carotid artery

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2603693 (ID_REF), GDS5651, NM_172894, SAPS1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 129953466

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7556209316.

Ppp6r1 - Regulatory, pathogenic and control CD4+ T cells

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL6246, 10559610 (ID_REF), GDS3999, NM_172894, AK122450, BC053076, BC141039, chr7:4631495-4658950 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 75562093

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5462018617.

Ppp6r1 - Skin carcinogenesis model

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL4234, 3140411 (ID_REF), GDS3334, NM_172894

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 54620186

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9967619318.

Ppp6r1 - Lipopolysaccharide-stimulated, NFκB ζ inhibitor (IκBζ) deficient-peritoneal macrophages

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL6246, 10559610 (ID_REF), GDS4578, NM_172894, AK122450, BC053076, BC141039, chr7:4631495-4658950 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 99676193

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7212849319.

Ppp6r1 - Directed differentiation of embryonic stem cells and induced pluripotent stem cells

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL6246, 10559610 (ID_REF), GDS3904, NM_172894, AK122450, BC053076, BC141039, chr7:4631495-4658950 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 72128493

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11440629320.

Ppp6r1 - Transforming growth factor beta effect on cytokine-activated, NOD-derived, splenic natural killer cells

Annotation:: Ppp6r1, protein phosphatase 6, regulatory subunit 1

Organism:: Mus musculus

Reporter:: GPL6246, 10559610 (ID_REF), GDS4948, NM_172894, AK122450, BC053076, BC141039, chr7:4631495-4658950 (SPOT ID)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 114406293

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 17

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 34536814) (338)
GEO Profiles
neuroligin-1 isoform X9 [Mus musculus]
neuroligin-1 isoform X9 [Mus musculus]
gi|1907149425|ref|XP_036018848.1|

Protein

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 338

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity