GEO Profiles Links for Nucleotide (Select 111038138) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 372

<< First< Prev

Page of 19

Next >Last >>

Select item 1159420361.

Ap3b2 - Auditory fear conditioning effect on amygdala: time course

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3009184 (ID_REF), GDS5157, NM_021492, AP3B2 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115942036

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 731668712.

Ap3b2 - Embryonic fibroblast response to forced expression of select transcription factors

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3009184 (ID_REF), GDS3932, NM_021492

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 73166871

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74735973.

Ap3b2 - MPSS transcriptome analysis project

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCTCCCCCTCGCCTCT (ID_REF), GDS868, NM_021492

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7473597

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1114188714.

Ap3b2 - Insm1 deficiency effect on the fetal pituitary gland

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3009184 (ID_REF), GDS5066, NM_021492

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 111418871

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756919225.

Ap3b2 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6481, 102350538 (ID_REF), GDS4002, NM_021492, Ap3b2 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75691922

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1212955716.

Ap3b2 - Restless Legs Syndrome model: adult whole brain

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3009184 (ID_REF), GDS5299, NM_021492

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 121295571

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 719144717.

Ap3b2 - Fear conditioning effect on hybrid mouse diversity panel: hippocampus and striatum

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3009184 (ID_REF), GDS3900, NM_021492

DataSet type:: Expression profiling by array, count, 198 samples

ID:: 71914471

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 616243368.

Ap3b2 - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3009184 (ID_REF), GDS3582, NM_021492, AP3B2 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61624336

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 927403709.

Ap3b2 - Zinc finger transcription factor Fezf1 deficiency effect on main olfactory epithelial cells

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6246, 10565102 (ID_REF), GDS4446, NM_021492, AY528675, BC024722, BC030306, BC139378, BC139379, chr7:81460399-81493925 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 92740370

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7283582010.

Ap3b2 - Spatial and temporal development of mammalian salivary glands

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P486681 (ID_REF), GDS3922, NM_021492, A_51_P486681 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72835820

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 8088547011.

Ap3b2 - Dopaminergic transcription factors Ascl1, Lmx1a, Nurr1 combined effect on embryonic fibroblasts

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6246, 10565102 (ID_REF), GDS4155, NM_021492, AY528675, BC024722, BC030306, BC139378, BC139379, chr7:81460399-81493925 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 80885470

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4559993112.

Ap3b2 - Ultrafine particles effect on ovalbumin-sensitized lungs

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL4636, 17831 (ID_REF), GDS2976, NM_021492

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 45599931

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13038654413.

Ap3b2 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL4134, 41544 (ID_REF), GDS5664, NM_021492, A_51_P486681 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130386544

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9684297014.

Ap3b2 - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6246, 10565102 (ID_REF), GDS4486, NM_021492, AY528675, BC024722, BC030306, BC139378, BC139379, chr7:81460399-81493925 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96842970

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3273643315.

Ap3b2 - Prostate cancer progression model: stromal cell

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL4371, 13033 (ID_REF), GDS2443, NM_021492

DataSet type:: Expression profiling by array, log2 ratio, 10 samples

ID:: 32736433

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13231522016.

Ap3b2 - Transcription factor engrailed-2 loss-of-function model of autism spectrum disorder: hippocampus

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P486681 (ID_REF), GDS6016, NM_021492, A_51_P486681 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 132315220

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11594203517.

Ap3b2 - Auditory fear conditioning effect on amygdala: time course

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2647729 (ID_REF), GDS5157, NM_021492, AP3B2 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115942035

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12910707018.

Ap3b2 - Circadian nuclear receptor REV-ERBα deficiency effect on ventral midbrain

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6246, 10565102 (ID_REF), GDS5628, NM_021492, AY528675, BC024722, BC030306, BC139378, BC139379, chr7:81460399-81493925 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129107070

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6256475019.

Ap3b2 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6333, scl31109.12.1_24-S (ID_REF), GDS3621, NM_021492, Ap3b2 (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62564750

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6162433520.

Ap3b2 - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2647729 (ID_REF), GDS3582, NM_021492, AP3B2 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61624335

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 19

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 111038138) (372)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 372

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity