GEO Profile Links for Gene (Select 22598) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1480

<< First< Prev

Page of 74

Next >Last >>

Select item 183769791.

Slc6a18 - MyD88-deficient macrophage response to lipopolysaccharide and E. coli

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL1226, 379 (ID_REF), GDS1705, AF075262

DataSet type:: Expression profiling by array, log2 ratio, 16 samples

ID:: 18376979

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 644489712.

Slc6a18 - Hypertension model: kidney

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL9734, 100082582_TGI_at (ID_REF), GDS3675, NM_001040692

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64448971

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644617753.

Slc6a18 - Hypertension model: kidney

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL9734, 100098730_TGI_at (ID_REF), GDS3675, BC022660

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64461775

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 529767474.

Slc6a18 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL2872, 30347 (ID_REF), GDS3259, NM_001040692, A_52_P196776 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52976747

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 441881845.

Slc6a18 - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL891, 22484 (ID_REF), GDS2924, NM_001040692, A_51_P372073 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44188184

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 183912796.

Slc6a18 - MyD88-deficient macrophage response to lipopolysaccharide and E. coli (dye swap)

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL1226, 379 (ID_REF), GDS1706, AF075262

DataSet type:: Expression profiling by array, log2 ratio, 15 samples

ID:: 18391279

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 905580747.

Slc6a18 - HIV-associated nephropathy model: kidney

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL1261, 1451879_a_at (ID_REF), GDS4220, 22598 (Gene ID), AF075266

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 90558074

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74974168.

Slc6a18 - MPSS transcriptome analysis project

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGGGTTGGGAGGAAGA (ID_REF), GDS868, BC010748

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7497416

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 874726749.

Slc6a18 - Heart, kidney and lung during juvenile growth

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL1261, 1451879_a_at (ID_REF), GDS4316, 22598 (Gene ID), AF075266

DataSet type:: Expression profiling by array, count, 40 samples

ID:: 87472674

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10375247410.

Slc6a18 - Pan-peroxisome proliferator-activated receptor agonist effect on various tissues: dose response

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL1261, 1451879_a_at (ID_REF), GDS4806, 22598 (Gene ID), AF075266

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 103752474

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5568657411.

Slc6a18 - Dent disease model: renal proximal tubules

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL1261, 1451879_a_at (ID_REF), GDS3397, 22598 (Gene ID), AF075266

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 55686574

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2394354212.

Slc6a18 - Hoxa11/Hoxd11 null mutation effect on embryonic kidney development (MG-430A)

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL339, 1451879_a_at (ID_REF), GDS2030, 22598 (Gene ID), AF075266

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 23943542

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 437254213.

Slc6a18 - Sex specific transcription in somatic and reproductive tissues

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL339, 1451879_a_at (ID_REF), GDS565, 22598 (Gene ID), AF075266

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 4372542

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7524557414.

Slc6a18 - Uninephrectomy effect on OVE26 diabetic kidney

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL1261, 1451879_a_at (ID_REF), GDS3990, 22598 (Gene ID), AF075266

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 75245574

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6230311215.

Slc6a18 - Claudin16 deficiency effect on kidneys

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2707290 (ID_REF), GDS3612, NM_001040692, SLC6A18 (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 62303112

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5297778116.

Slc6a18 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL2872, 31381 (ID_REF), GDS3259, NM_001040692, A_51_P372074 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52977781

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 749550317.

Slc6a18 - MPSS transcriptome analysis project

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL1010, GATCCACAGGTGCAGATTCC (ID_REF), GDS868, AK085258

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7495503

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 13044065918.

Slc6a18 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P372074 (ID_REF), GDS5666, NM_001040692, A_51_P372074 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130440659

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3131183719.

Slc6a18 - 2,3,7,8-tetrachlorodibenzo-p-dioxin effect on cultured embryonic teeth

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL81, 97465_at (ID_REF), GDS2383, 22598 (Gene ID), AF075267

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 31311837

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7063127420.

Slc6a18 - Embryonic development of male reproductive tract tissues

Annotation:: Slc6a18, solute carrier family 6 (neurotransmitter transporter), member 18

Organism:: Mus musculus

Reporter:: GPL1261, 1451879_a_at (ID_REF), GDS3862, 22598 (Gene ID), AF075266

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 70631274

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 74

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 22598) (1480)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1480

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity