|
Status |
Public on Aug 08, 2014 |
Title |
T4V replicate 1 |
Sample type |
SRA |
|
|
Source name |
T4V_RNA-seq
|
Organism |
Saccharomyces cerevisiae |
Characteristics |
genotype/variation: T4V mutation in RNAP II CTD
|
Extracted molecule |
polyA RNA |
Extraction protocol |
Phenol/choloroform method was used to extract RNA. For RNA sequencing analyses, the integrity of total RNA was measured by Agilent Bioanalyzer. RNA samples with an integrity number >8.0 were used for further processing. Total RNA was subjected to 2 rounds of poly(A) selection using oligo-dT magnetic beads (NEB) followed by fragmentation using Ambion’s RNA fragmentation kit at 70°C for 5 min. Fragmented RNA was purified by ethanol precipitation followed by dephosphorylation using recombinant shrimp alkaline phosphatase (NEB) and then phosphorylation using T4 kinase (NEB). Phosphorylated RNA was then purified by RNeasy kit (Qiagen) and was sequentially ligated to a 5′-adenylated 3′ adapter (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) with the truncated T4 RNA ligase 2 (NEB) and to a 5′ adapter (5′- GUUCAGAGUUCUACAGUCCGACGAUC) with T4 RNA ligase 1 (NEB). The resultant RNA was reverse-transcribed to cDNA with Superscript III (Invitrogen), and the cDNA was amplified by 12 cycles of PCR with Phusion high fidelity polymerase (NEB). Amplified cDNAs were separated on 8% polyacrylamide gels. cDNAs containing an inset size ~100 nt were purified from the gel based on the size. The quality and quantity of the cDNA library were evaluated by Agilent Bioanalyzer and qPCR analysis. The strand-specific cDNA libraries generated by this protocol were sequenced on an Illumina Genome Analyzer IIx.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina Genome Analyzer IIx |
|
|
Data processing |
Reads were mapped to yeast genome (sacCer3) using bowtie2 (local mode). Reads with a mapping quality score (MAPQ) of ≥10 were selected for further analysis. mRNA abundance was measured using reads per kilobase per million reads (RPKM) based on CDS regions of Ensembl Gene sequences Genome_build: sacCer3 Supplementary_files_format_and_content: tab delimited file containing information of gene symbol, Ensembl transcript ID and RPKM value of transcript (based on CDS region of transcripts)
|
|
|
Submission date |
Aug 07, 2014 |
Last update date |
May 15, 2019 |
Contact name |
Wencheng Li |
Organization name |
PTC Therapeutics
|
Street address |
100 Corporate Count
|
City |
South Plainfield |
State/province |
NJ - New Jersey |
ZIP/Postal code |
07080 |
Country |
USA |
|
|
Platform ID |
GPL13272 |
Series (1) |
GSE60181 |
Threonine-4 of the budding yeast RNAP II CTD couples transcription with Htz1-mediated chromatin remodeling |
|
Relations |
BioSample |
SAMN02953983 |
SRA |
SRX671579 |