|
| Status |
Public on Aug 29, 2013 |
| Title |
Mex67_1 |
| Sample type |
SRA |
| |
|
| Source name |
BY4741_Mex67-HTP
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
strain: BY4741 (MATa; his3-delta-1; leu2-delta-0; lys2-delta-0; ura3-delta-0)
tagged protein: Mex67-HTP
growth medium: SD (-TRP)
|
| Treatment protocol |
Yeast cultures were irradiated with UV light, to fix protein:RNA interactions
|
| Growth protocol |
Yeast cultures were grown in SD (-TRP, or -TRP -LEU -URA) medium at 30C to OD=0.5
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cell lysate
Extracts from UV-crosslinked yeast cells were used to isolate RNAs cross-linked to a tagged protein in a 2-step purification protocol. Recovered RNAs are subjected to limited RNAse digest, linker ligation and cDNA amplification, and identified by Illumina sequencing (according to Granneman et al., PNAS, 2009).
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Description |
Sample 4
All sequences start with the barcode GA
|
| Data processing |
Reads were pre-processed using the fastx toolkit: fastx_clipper -a TGGAATTCTCGGGTGCCAAGGC -l 15 | fastq_quality_trimmer -t 30 | fastq_quality_filter -q 23 -p 100 | fastx_artifacts_filter
Reads with identical sequence were collapsed, then barcodes removed (between 2 and 11 nt long)
Reads were mapped to the S. cerevisiae genome (SGDv64) using Novoalign with the following settings: -r Random -s 1
Subsequent analyses were performed using custom python and AWK scripts, and the pyCRAC package (Granneman, Webb and Kudla, submitted)
Genome_build: SGDv64 (GenBank Assembly ID: GCA_000146045.2)
Supplementary_files_format_and_content: SGR files generated using pyCRAC (Granneman, Webb and Kudla, submitted); these are pileups of all mapped reads across the genome; these are not normalised to the total number of reads in each library
|
| |
|
| Submission date |
May 08, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Alex Charles Tuck |
| Organization name |
Friedrich Miescher Institute for Biomedical Research
|
| Street address |
Maulbeerstrasse 66
|
| City |
Basel |
| ZIP/Postal code |
4058 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL13272 |
| Series (1) |
| GSE46742 |
A transcriptome-wide atlas of RNP compositions reveals diverse classes of mRNAs and lncRNAs |
|
| Relations |
| BioSample |
SAMN02141425 |
| SRA |
SRX276086 |
