|
| Status |
Public on Dec 10, 2009 |
| Title |
Genes regulated after knock-down of Pirin in U937 cells |
| Organism |
Homo sapiens |
| Experiment type |
Expression profiling by array
|
| Summary |
Pirin (PIR) is a putative transcriptional regulator whose expression is silenced in cells bearing the AML1/ETO and PML/RAR leukemogenic fusion proteins and is significantly repressed in a large proportion of acute myeloid leukemias. PIR expression increases during in vitro myeloid differentiation of primary hematopoietic precursor cells, and ablation of PIR in the U937 myelomonocytic cell line or in murine primary hematopoietic precursor cells results in impairment of terminal myeloid differentiation.
Keywords: Transcriptional regulation, knock-down using shRNA
|
| |
|
| Overall design |
We analyzed gene expression profiles of U937 cells after knock-down of PIR using the shPIR#7 oligonucleotides cloned in the pSICO-R lentiviral vector. No residual PIR protein is detectable in U937-shPIR#7 cells by Western blotting. U937 cells containing the empty cloning vector (U937-pSICO) were used as control.
shPIR#7 oligonucleotide sequences:
Human PIR#7-for:
TGAAGCCACTTTGTCTTAATTTCAAGAGAATTAAGACAAAGTGGCTTCTTTTTTC
Human PIR#7-rev:
TCGAGAAAAAAGAAGCCACTTTGTCTTAATTCTCTTGAAATTAAGACAAAGTGGCTTCA
For each sample, an RNA pool was obtained by mixing equal quantities of total RNA from each of three independent RNA extractions. Each biotin-labeled target was hybridized to two GeneChip HG-U133 Plus v.2 arrays.
|
| |
|
| Contributor(s) |
Alcalay M |
| Citation(s) |
20010624 |
| Submission date |
Jun 24, 2009 |
| Last update date |
Mar 25, 2019 |
| Contact name |
Myriam Alcalay |
| E-mail(s) |
myriam.alcalay@ieo.eu
|
| Organization name |
European Institute of Oncology
|
| Department |
Experimental Oncology
|
| Lab |
Functional Genomics
|
| Street address |
Via Adamello 16
|
| City |
Milan |
| ZIP/Postal code |
20139 |
| Country |
Italy |
| |
|
| Platforms (1) |
| GPL570 |
[HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array |
|
| Samples (4)
|
| GSM421933 |
U937 cells with knock-down of Pirin - Replica 1 |
| GSM421934 |
U937 cells with knock-down of Pirin - Replica 2 |
| GSM421935 |
U937 cells infected with empty pSICO-R vector - Replica 1 |
| GSM421936 |
U937 cells infected with empty pSICO-R vector - Replica 2 |
|
| Relations |
| BioProject |
PRJNA117507 |
Less...
More...