Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 22

1.
Value/Rank Plot

Gm11696 - Liver response to Pacific ciguatoxin-1: time course

Annotation:
Gm11696, predicted gene 11696
Organism:
Mus musculus
Reporter:
GPL2872, 36003 (ID_REF), GDS3259, BC062114, A_52_P633785 (SPOT ID)
DataSet type:
Expression profiling by array, log10 ratio, 9 samples
2.
Value/Rank Plot

Gm11696 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:
Gm11696, predicted gene 11696
Organism:
Mus musculus
Reporter:
GPL4134, 10136 (ID_REF), GDS5461, BC062114, A_52_P633785 (SPOT ID)
DataSet type:
Expression profiling by array, count, 18 samples
3.
Value/Rank Plot

Gm11696 - Caspase-1 deficiency effect on fasted liver

Annotation:
Gm11696, predicted gene 11696 (multiple annotations exist)
Organism:
Mus musculus
Reporter:
GPL11533, 10392437 (ID_REF), GDS4922, NM_010303, BC062114, chr11:109216094-109224931 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 6 samples
4.
Value/Rank Plot

Gm11696 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:
Gm11696, predicted gene 11696
Organism:
Mus musculus
Reporter:
GPL4134, 10136 (ID_REF), GDS5664, BC062114, A_52_P633785 (SPOT ID)
DataSet type:
Expression profiling by array, count, 12 samples
5.
Value/Rank Plot

Gm11696 - Fasting effect on vanin-1 depleted liver

Annotation:
Gm11696, predicted gene 11696 (multiple annotations exist)
Organism:
Mus musculus
Reporter:
GPL11533, 10392437 (ID_REF), GDS4872, NM_010303, BC062114, chr11:109216094-109224931 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 16 samples
6.
Value/Rank Plot

Gm11696 - Interleukin-22 effect on colon cultures

Annotation:
Gm11696, predicted gene 11696
Organism:
Mus musculus
Reporter:
GPL2872, 36003 (ID_REF), GDS3226, BC062114, A_52_P633785 (SPOT ID)
DataSet type:
Expression profiling by array, log10 ratio, 6 samples
7.
Value/Rank Plot

Gm11696 - Industrial pollution effect on liver

Annotation:
Gm11696, predicted gene 11696
Organism:
Mus musculus, Mus spretus
Reporter:
GPL4134, 10136 (ID_REF), GDS5331, BC062114, A_52_P633785 (SPOT ID)
DataSet type:
Expression profiling by array, count, 19 samples
8.
Value/Rank Plot

Gm11696 - Glucocorticoid effect on the female liver

Annotation:
Gm11696, predicted gene 11696
Organism:
Mus musculus
Reporter:
GPL4134, 10136 (ID_REF), GDS5036, BC062114, A_52_P633785 (SPOT ID)
DataSet type:
Expression profiling by array, count, 6 samples
9.
Value/Rank Plot

Gm11696 - Fasting effect on white adipose tissue, liver and skeletal muscle

Annotation:
Gm11696, predicted gene 11696 (multiple annotations exist)
Organism:
Mus musculus
Reporter:
GPL11533, 10392437 (ID_REF), GDS4918, NM_010303, BC062114, chr11:109216094-109224931 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 30 samples
10.
Value/Rank Plot

Gm11696 - Diabetic db/db heart response to rosiglitazone

Annotation:
Gm11696, predicted gene 11696
Organism:
Mus musculus
Reporter:
GPL4134, 10136 (ID_REF), GDS4990, BC062114, A_52_P633785 (SPOT ID)
DataSet type:
Expression profiling by array, log10 ratio, 15 samples
11.
Value/Rank Plot

Gm11696 - Glucocorticoid effect on the male liver

Annotation:
Gm11696, predicted gene 11696
Organism:
Mus musculus
Reporter:
GPL4134, 10136 (ID_REF), GDS5035, BC062114, A_52_P633785 (SPOT ID)
DataSet type:
Expression profiling by array, count, 6 samples
12.
Value/Rank Plot

Gm11696 - Sparsely or densely ionizing radiation effect on mammary gland: dose response and time course

Annotation:
Gm11696, predicted gene 11696 (multiple annotations exist)
Organism:
Mus musculus
Reporter:
GPL11533, 10392437 (ID_REF), GDS4905, NM_010303, BC062114, chr11:109216094-109224931 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 37 samples
13.
Value/Rank Plot

Gm11696 - Resveratrol and high-fat high-calorie diet effect on liver

Annotation:
Gm11696, predicted gene 11696
Organism:
Mus musculus
Reporter:
GPL2872, 36003 (ID_REF), GDS2413, BC062114, A_52_P633785 (SPOT ID)
DataSet type:
Expression profiling by array, Z-score, 14 samples
14.
Value/Rank Plot

Gm11696 - Maternal western-style high fat diet effect on liver of two-week-old offspring

Annotation:
Gm11696, predicted gene 11696 (multiple annotations exist)
Organism:
Mus musculus
Reporter:
GPL11533, 10392437 (ID_REF), GDS4774, NM_010303, BC062114, chr11:109216094-109224931 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 27 samples
15.
Value/Rank Plot

Gm11696 - Caspase-1 deficiency effect on lipid-loaded intestines

Annotation:
Gm11696, predicted gene 11696 (multiple annotations exist)
Organism:
Mus musculus
Reporter:
GPL11533, 10392437 (ID_REF), GDS6176, NM_010303, BC062114, chr11:109216094-109224931 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 18 samples
16.
Value/Rank Plot

Gm11696 - Conventionalization of germ-free C57BL/6 males: time course

Annotation:
Gm11696, predicted gene 11696 (multiple annotations exist)
Organism:
Mus musculus
Reporter:
GPL11533, 10392437 (ID_REF), GDS4319, NM_010303, BC062114, chr11:109216094-109224931 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 144 samples
17.
Value/Rank Plot

Gm11696 - Iron enriched and deficient diets effect on the liver

Annotation:
Gm11696, predicted gene 11696
Organism:
Mus musculus
Reporter:
GPL4134, 10136 (ID_REF), GDS3373, BC062114, A_52_P633785 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 30 samples
18.
Value/Rank Plot

Gm11696 - c-Jun N-terminal kinase-1 deletion effect on bile duct ligation model of liver fibrosis: time course

Annotation:
Gm11696, predicted gene 11696 (multiple annotations exist)
Organism:
Mus musculus
Reporter:
GPL11533, 10392437 (ID_REF), GDS4878, NM_010303, BC062114, chr11:109216094-109224931 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 24 samples
19.
Value/Rank Plot

Gm11696 - P81S von Hippel-Lindau mutation effect on embryonic stem cell teratomas

Annotation:
Gm11696, predicted gene 11696 (multiple annotations exist)
Organism:
Mus musculus
Reporter:
GPL11533, 10392437 (ID_REF), GDS4865, NM_010303, BC062114, chr11:109216094-109224931 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 10 samples
20.
Value/Rank Plot

Gm11696 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Gm11696, predicted gene 11696
Organism:
Mus musculus
Reporter:
GPL1010, GATCCAGAGAAACCCTGTGA (ID_REF), GDS878, BC062114
DataSet type:
Expression profiling by MPSS, count, 6 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center