Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 670

1.
Value/Rank Plot

Gm2137 - Chronic cardiac pressure overload effect on adrenal medulla

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL1261, 1444008_at (ID_REF), GDS3978, BB396393
DataSet type:
Expression profiling by array, count, 6 samples
2.
Value/Rank Plot

Gm2137 - Nodose and dorsal root ganglia comparison (MG-430 2.0)

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL1261, 1444008_at (ID_REF), GDS1635, BB396393
DataSet type:
Expression profiling by array, count, 20 samples
3.
Value/Rank Plot

Gm2137 - Inbred Long Sleep and Inbred Short Sleep model of ethanol sensitivity: cerebellum (MG-430B)

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL340, 1444008_at (ID_REF), GDS1610, BB396393
DataSet type:
Expression profiling by array, count, 4 samples
4.
Value/Rank Plot

Gm2137 - Ras-associated binding protein 3A mutations effect on brain cortices and hippocampi (MG-430B)

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL340, 1444008_at (ID_REF), GDS2483, BB396393
DataSet type:
Expression profiling by array, count, 36 samples
5.
Value/Rank Plot

Gm2137 - SARM-deficient brain response to vesicular stomatitis virus infection

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL1261, 1444008_at (ID_REF), GDS4842, BB396393
DataSet type:
Expression profiling by array, count, 12 samples
6.
Value/Rank Plot

Gm2137 - Fetal male and female gonadal somatic support cells

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL1261, 1444008_at (ID_REF), GDS2222, BB396393
DataSet type:
Expression profiling by array, transformed count, 4 samples
7.
Value/Rank Plot

Gm2137 - Polycomb group protein CBX2 deficiency effect on XY and XX embryonic gonads

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL1261, 1444008_at (ID_REF), GDS4445, BB396393
DataSet type:
Expression profiling by array, transformed count, 12 samples
8.
Value/Rank Plot

Gm2137 - Spatial and temporal development of mammalian salivary glands

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL7202, A_52_P1180506 (ID_REF), GDS3922, AK082723, A_52_P1180506 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 84 samples
9.
Value/Rank Plot

Gm2137 - Wild type embryonic tooth germ tissue

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL1261, 1444008_at (ID_REF), GDS4453, BB396393
DataSet type:
Expression profiling by array, count, 6 samples
10.
Value/Rank Plot

Gm2137 - Nephrogenesis: embryonic kidney segments

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL1261, 1444008_at (ID_REF), GDS3865, BB396393
DataSet type:
Expression profiling by array, count, 37 samples
11.
Value/Rank Plot

Gm2137 - Uniparental duplication of chromosome 7 regions effect on embryo and newborn brain (MG-430B)

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL340, 1444008_at (ID_REF), GDS2281, BB396393
DataSet type:
Expression profiling by array, count, 4 samples
12.
Value/Rank Plot

Gm2137 - Hoxa11/Hoxd11 null mutation effect on embryonic kidney development (MG-430B)

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL340, 1444008_at (ID_REF), GDS2031, BB396393
DataSet type:
Expression profiling by array, count, 14 samples
13.
Value/Rank Plot

Gm2137 - Forelimb and hindlimb embryonic autopod comparison (MG-430B)

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL340, 1444008_at (ID_REF), GDS1343, BB396393
DataSet type:
Expression profiling by array, count, 6 samples
14.
Value/Rank Plot

Gm2137 - Limb bud zone of polarizing activity

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL1261, 1444008_at (ID_REF), GDS3403, BB396393
DataSet type:
Expression profiling by array, count, 8 samples
15.
Value/Rank Plot

Gm2137 - Metastatic neuroblastoma model: abdominal neuroblastoma tumors

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL1261, 1444008_at (ID_REF), GDS4617, BB396393
DataSet type:
Expression profiling by array, transformed count, 29 samples
16.
Value/Rank Plot

Gm2137 - Amyloid precursor protein double mutant and amyloid precursor-like protein 2 deficiency effects on adult brain regions

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL1261, 1444008_at (ID_REF), GDS4134, BB396393
DataSet type:
Expression profiling by array, transformed count, 12 samples
17.
Value/Rank Plot

Gm2137 - Transcription factor Oct-1 deficient fibroblast response to ionizing radiation (430B)

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL340, 1444008_at (ID_REF), GDS1446, BB396393
DataSet type:
Expression profiling by array, transformed count, 16 samples
18.
Value/Rank Plot

Gm2137 - MPSS transcriptome analysis project

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL1010, GATCCAGATGTGCTTCCTGG (ID_REF), GDS868, AK082723
DataSet type:
Expression profiling by MPSS, count, 87 samples
19.
Value/Rank Plot

Gm2137 - Heat shock protein 90 inhibitor effect on Huntington’s disease model: brain striatum

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL1261, 1444008_at (ID_REF), GDS5337, BB396393
DataSet type:
Expression profiling by array, transformed count, 32 samples
20.
Value/Rank Plot

Gm2137 - Glucose effect on young and aged pancreatic islets: dose response

Annotation:
Gm2137, predicted gene 2137
Organism:
Mus musculus
Reporter:
GPL1261, 1444008_at (ID_REF), GDS4939, BB396393
DataSet type:
Expression profiling by array, count, 20 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center