#ID = 
#DESCRIPTION = official gene name
#GB_ACC = GenBank Accession number
#SPOT_ID = alternative spot identifier (positive and negative controls)
#SEQUENCE = RNA sequence targeted by the probe
#TYPE = Type of probe, endogenous = measured gene, housekeeping gene = used for normalization, positive and negative = internal controls
ID	DESCRIPTION	GB_ACC	SPOT_ID	SEQUENCE	TYPE
POS_A			ERCC_00117.1		positive
POS_B			ERCC_00112.1		positive
POS_C			ERCC_00002.1		positive
POS_D			ERCC_00092.1		positive
POS_E			ERCC_00035.1		positive
POS_F			ERCC_00034.1		positive
NEG_A			ERCC_00096.1		negative
NEG_B			ERCC_00041.1		negative
NEG_C			ERCC_00019.1		negative
NEG_D			ERCC_00076.1		negative
NEG_E			ERCC_00098.1		negative
NEG_F			ERCC_00126.1		negative
NEG_G			ERCC_00144.1		negative
NEG_H			ERCC_00154.1		negative
ACACA	acetyl-CoA carboxylase alpha	NM_198834.1		GACATGAACACTGTACTGAACTACATCTTCTCTCACGCTCAAGTCACCAAGAAGAATCTTCTGGTCACAATGCTTATTGATCAGTTGTGTGGCCGGGACC	endogenous
ACAD10	acyl-CoA dehydrogenase family member 10	NM_001136538.1		AAATGGGGCTCCCTCCCACTGAGAACTGGAACTTCTATATGGCTTTTTCCTTTTTCCGTGTGGCTGCAATCCTACAGGGAGTCTACAAGCGATCACTCAC	endogenous
ACADVL	acyl-CoA dehydrogenase very long chain	NM_001270447.1		ATCTAAGTCCTTTGCTGTGGGAATGTTCAAAGGCCAGCTCACCACAGATCAGGTGTTCCCATACCCGTCCGTGCTCAACGAAGAGCAGACACAGTTTCTT	endogenous
ACOT2	acyl-CoA thioesterase 2	NM_006821.4		CTCAGGTCTGAATTCAAAATGGCCTCATCTCCTGCTGTCCTTCGAGCGTCCCGGCTGTACCAATGGAGCCTGAAGAGTTCGGCGCAGTTCCTGGGGTCTC	endogenous
ACSF2	acyl-CoA synthetase family member 2	NM_001288968.1		GATCCAGAAATTCAAACTTCGAGAGCAGATGGAACGACATCTAAATCTGTGAATAAAGCAGCAGGCCTGTCCTGGCCGGTTGGCTTGACTCTCTCCTGTC	endogenous
ACSL5	acyl-CoA synthetase long chain family member 5	NM_203379.1		CCAACATTGAAAGCAAAGCGAGGAGAGCTTTCCAAATACTTTCGGACCCAAATTGACAGCCTGTATGAGCACATCCAGGATTAGGATAAGGTACTTAAGT	endogenous
ACTN1	actinin alpha 1	NM_001102.3		CCGCGAGACAGCCGACACAGATACAGCAGACCAAGTCATGGCTTCCTTCAAGATCCTGGCTGGGGACAAGAACTACATTACCATGGACGAGCTGCGCCGC	endogenous
ACVR1B	activin A receptor type 1B	NM_020328.3		ACATGGAAGATCCCTCATGTGAGATGTGTCTCTCCAAAGACAAGACGCTCCAGGATCTTGTCTACGATCTCTCCACCTCAGGGTCTGGCTCAGGGTTACC	endogenous
ACVR1C	activin A receptor type 1C	NM_145259.2		GGAATTTTGCCACCATGTGACTTATTGGGGCAGAGAAAACTCAGGGTTGTCTTTGAGTCTGCACAAAAGCACCAGGGAACCTGCTTAGCAAATCGTCTGA	endogenous
ACVR2A	activin A receptor type 2A	NM_001616.3		ACATGGCTCCAGAGGTATTAGAGGGTGCTATAAACTTCCAAAGGGATGCATTTTTGAGGATAGATATGTATGCCATGGGATTAGTCCTATGGGAACTGGC	endogenous
ADAR	adenosine deaminase, RNA specific	NM_001111.3		ATCTAGCAAGCCTGTAGTATTCAGTTTCTGTTGTAGGAAGAGAGCGAGGCATCCCTGAATTCCACGCATCTGCTGGAAACGAGCCGTGTCAGATCGCACA	endogenous
ADD1	adducin 1	NM_001119.4		ACGGTGTAAATTGGCAGCGTTTTATAGACTAGCAGATCTCTTTGGGTGGTCTCAGCTTATCTACAATCATATCACAACCAGAGTGAACTCCGAGCAGGAA	endogenous
ADORA2A	adenosine A2a receptor	NM_000675.3		TGGCCATCGTCCTCTCCCACACCAATTCGGTTGTGAATCCCTTCATCTACGCCTACCGTATCCGCGAGTTCCGCCAGACCTTCCGCAAGATCATTCGCAG	endogenous
AFDN	afadin, adherens junction formation factor	NM_001040000.2		GCCTAGACCTGAAGCCTACCCCATCCCCACTCAGACGTACACCAGAGAGTATTTTACCTTCCCAGCTTCCAAATCCCAGGATCGGATGGCTCCTCCTCAG	endogenous
AHR	aryl hydrocarbon receptor	NM_001621.3		CTGCTACCACATCCACTCTAAGCAAGGACTCTCTCAATCCTAGTTCCCTCCTGGCTGCCATGATGCAACAAGATGAGTCTATTTATCTCTATCCTGCTTC	endogenous
AKT1	AKT serine/threonine kinase 1	NM_001014432.1		GGACGGGCACATTAAGATCACAGACTTCGGGCTGTGCAAGGAGGGGATCAAGGACGGTGCCACCATGAAGACCTTTTGCGGCACACCTGAGTACCTGGCC	endogenous
AKT2	AKT serine/threonine kinase 2	NM_001626.4		AGGAGATGGAAGTGGCGGTCAGCAAGGCACGGGCTAAAGTGACCATGAATGACTTCGACTATCTCAAACTCCTTGGCAAGGGAACCTTTGGCAAAGTCAT	endogenous
ALDH1L1	aldehyde dehydrogenase 1 family member L1	NM_012190.2		AGAAGGATGGAGTGCCGGTATTCAAGTACTCCCGGTGGCGTGCAAAAGGACAGGCTTTGCCTGATGTGGTGGCAAAATACCAGGCTTTGGGGGCCGAGCT	endogenous
ALDH1L2	aldehyde dehydrogenase 1 family member L2	NM_001034173.3		CAACAGACTTCTTTAAATCTGGAGCAAGCTCAATGGATGTTGCCAGGCTGGTTGAAGAGATCAGACAGAAATGTGGTGGGCTTCAGTTGCAGAATGAAGA	endogenous
ALDH3A2	aldehyde dehydrogenase 3 family member A2	NM_001031806.1		ATTGTTTGCAGACGCATAACCTGGGGAAAATACATGAATTGTGGCCAAACCTGCATTGCACCCGACTATATTCTCTGTGAAGCATCCCTCCAAAATCAAA	endogenous
ALDH8A1	aldehyde dehydrogenase 8 family member A1	NM_001193480.1		CACTAGCATGGCTAATTGATCATTGATTGGACCTCATTACATAAGGGGGCTGTGGACGTCTTTGGAATTTGTTAGGGGAAGGCTATGTGGTAAGCTCTAC	endogenous
ALDOA	aldolase, fructose-bisphosphate A	NM_184041.2		AGGCTGGCTTGCCCGCGCTCTTTCTTCCCTCGTGACAGTGGTGTGTGGTGTCGTCTGTGAATGCTAAGTCCATCACCCTTTCCGGCACACTGCCAAATAA	endogenous
ALDOC	aldolase, fructose-bisphosphate C	NM_005165.2		GCATGGCCAAGCGGCTGAGCCAAATTGGGGTGGAAAACACAGAGGAGAACCGCCGGCTGTACCGCCAGGTCCTGTTCAGTGCTGATGACCGTGTGAAAAA	endogenous
ANGPT2	angiopoietin 2	NM_001147.2		TCGCTCAAGGCCACAACCATGATGATCCGACCAGCAGATTTCTAAACATCCCAGTCCACCTGAGGAACTGTCTCGAACTATTTTCAAAGACTTAAGCCCA	endogenous
APC	APC, WNT signaling pathway regulator	NM_000038.3		AAACAGCCACCACTTCTCCTAGAGGAGCCAAGCCATCTGTGAAATCAGAATTAAGCCCTGTTGCCAGGCAGACATCCCAAATAGGTGGGTCAAGTAAAGC	endogenous
ARAF	A-Raf proto-oncogene, serine/threonine kinase	NM_001654.3		GTGGGCACCGTCAAAGTATACCTGCCCAACAAGCAACGCACGGTGGTGACTGTCCGGGATGGCATGAGTGTCTACGACTCTCTAGACAAGGCCCTGAAGG	endogenous
AREG	amphiregulin	NM_001657.2		ACAAGACGGAAAGTGAAAATACTTCAGATAAACCCAAAAGAAAGAAAAAGGGAGGCAAAAATGGAAAAAATAGAAGAAACAGAAAGAAGAAAAATCCATG	endogenous
ATG14	autophagy related 14	NM_014924.3		AAACAGTATATCACCATTGGGTAGAGTGGACGGGACTCATGTAAGGACTCAATTTGGGGAAGAGCATTCAGTGGCATGCTGTTAGAGGACTAGTGTCCGA	endogenous
ATG7	autophagy related 7	NM_001136031.2		AGACTGCAGATAAGAAGCTCCTTTTGGAACAAGCAGCAAATGAGATATGGGAATCCATAAAATCAGGCACTGCTCTTGAAAACCCTGTACTCCTCAACAA	endogenous
ATP5MF	ATP synthase membrane subunit f	NM_004889.2		CCCTCCGTGAGGAACACAATCTCAATCGTTGCTGAATCCTTTCATATCCTAATAGGAATTAACCTCCAAATAAAACATGACTGGTACGTGTGCTGATTGC	endogenous
ATP5MG	ATP synthase membrane subunit g	NM_006476.4		AGTGGGACGGGGTCCTGCAGCGGGTCCTTCCGGCGGGTGACATTCAGCCGGCGGTTCGGGGCGACGGACTCTCCATTCCAGAACCATGGCCCAATTTGTC	endogenous
ATP5PD	ATP synthase peripheral stalk subunit d	NM_006356.2		TCCTGGAATGAGACCCTCACCTCCAGGTTGGCTGCTTTACCTGAGAATCCACCAGCTATCGACTGGGCTTACTACAAGGCCAATGTGGCCAAGGCTGGCT	endogenous
ATP6V1F	ATPase H+ transporting V1 subunit F	NM_001198909.1		AGGTGAGGCGCTTCTAGGTTGCTGGGGCTCTGCTGGTTAAGGAACAGGAAGCCTGACCATCTCCCTCCACTACCTCTTCCCTGTGCTGTTACACAGTGTC	endogenous
AURKA	aurora kinase A	NM_003600.2		AGCTCCAGTTGGAGGTCCAAAACGTGTTCTCGTGACTCAGCAATTTCCTTGTCAGAATCCATTACCTGTAAATAGTGGCCAGGCTCAGCGGGTCTTGTGT	endogenous
B3GAT1	beta-1,3-glucuronyltransferase 1	NM_054025.2		TGTCCGTGTGGCCCGTCGCCTTCGTGGGTGGCCTGCGGTACGAGGCCCCACGGGTGAACGGGGCAGGGAAGGTGGTCGGCTGGAAGACGGTGTTTGACCC	endogenous
BATF	basic leucine zipper ATF-like transcription factor	NM_006399.3		CCTGGCAAACAGGACTCATCTGATGATGTGAGAAGAGTTCAGAGGAGGGAGAAAAATCGTATTGCCGCCCAGAAGAGCCGACAGAGGCAGACACAGAAGG	endogenous
BATF3	basic leucine zipper ATF-like transcription factor 3	NM_018664.2		ACATCCAACAGGCGCCAAACTCACAGAGCCCTTGTGCAGATCCAGCATGGAGGCCACCCTCAGGAGTGACTTCTCATCCACCCTGGCAGCTAGTAGGTTC	endogenous
BCL2	BCL2, apoptosis regulator	NM_000657.2		AGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAACCGGGAGATGTCGCCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCACCT	endogenous
BCL2L1	BCL2 like 1	NM_138578.1		CTAAGAGCCATTTAGGGGCCACTTTTGACTAGGGATTCAGGCTGCTTGGGATAAAGATGCAAGGACCAGGACTCCCTCCTCACCTCTGGACTGGCTAGAG	endogenous
BCL6	B cell CLL/lymphoma 6	NM_001706.2		GTTGTGGACACTTGCCGGAAGTTTATTAAGGCCAGTGAAGCAGAGATGGTTTCTGCCATCAAGCCTCCTCGTGAAGAGTTCCTCAACAGCCGGATGCTGA	endogenous
BID	BH3 interacting domain death agonist	NM_197966.1		GCTTAGCTTTAGAAACAGTGCAACACTGGTCTGCTGTTCCAGTGGTAAGCTATGTCCCAGGAATCAGTTTAAAAGCACGACAGTGGATGCTGGGTCCATA	endogenous
BLK	BLK proto-oncogene, Src family tyrosine kinase	NM_001715.2		AGCTTCTTGCTCCAATCAACAAGGCCGGCTCCTTTCTTATCAGAGAGAGTGAAACCAACAAAGGTGCCTTCTCCCTGTCTGTGAAGGATGTCACCACCCA	endogenous
BTBD6	BTB domain containing 6	NM_033271.2		CAGATCCCTGAGCTCATTTTCTATGCCTGAGGTGCCCGGGGAGGCTGCAGCAGGTCAGCGAGTGAGTGGAGGGGAAGTCAAGATGCTAACTGCTTCTTGA	endogenous
BUB1	BUB1 mitotic checkpoint serine/threonine kinase	NM_004336.3		GAAGATAAAGAAAATGTGGTAGCAAAACAGTGTACCCAGGCGACTTTGGATTCTTGTGAGGAAAACATGGTGGTGCCTTCAAGGGATGGAAAATTCAGTC	endogenous
C3	complement C3	NM_000064.2		CATCTACCTGGACAAGGTCTCACACTCTGAGGATGACTGTCTAGCTTTCAAAGTTCACCAATACTTTAATGTAGAGCTTATCCAGCCTGGAGCAGTCAAG	endogenous
CALM1	calmodulin 1	NM_006888.3		ACCTTGCCTGAAAACAAGCAGATACCGATTGCTTCATCCTATTTATGGACATGTAGGTCTAGTTGCATTTTCACTGGGGGGAGGGGGGAAGGTGAATTAT	endogenous
CARD10	caspase recruitment domain family member 10	NM_014550.3		TGTCTGTGTCTTCTCCTTAAACACTCGCCCTGGAGTCTGTTCTCACACCTGTGCGCAGGTTTGCACACTCAAGTTCTCATGGGCAGGCTCAGGTCTGTCC	endogenous
CASP3	caspase 3	NM_004346.3		CCATCGCCAAGTAAGAAAGTGAAGCAAATCAGAAACTTGTGAAGTGGAAATGTTCTAAAGGTGGTGAGGCAATAAAAATCATAGTACTCTTTGTAGCAAA	endogenous
CASP8	caspase 8	NM_001228.4		AGATGGACTTCAGCAGAAATCTTTATGATATTGGGGAACAACTGGACAGTGAAGATCTGGCCTCCCTCAAGTTCCTGAGCCTGGACTACATTCCGCAAAG	endogenous
CBR4	carbonyl reductase 4	NM_032783.4		AAGATATGGTATCTCAGCTTCATACTAACCTCTTGGGTTCCATGCTGACCTGTAAAGCTGCCATGAGGACTATGATTCAACAACAGGGAGGGTCTATTGT	endogenous
CCL1	C-C motif chemokine ligand 1	NM_002981.1		CCTTCTCCAGATGTTGCTTCTCATTTGCGGAGCAAGAGATTCCCCTGAGGGCAATCCTGTGTTACAGAAATACCAGCTCCATCTGCTCCAATGAGGGCTT	endogenous
CCL11	C-C motif chemokine ligand 11	NM_002986.2		TGGGTGCAGGATTCCATGAAGTATCTGGACCAAAAATCTCCAACTCCAAAGCCATAAATAATCACCATTTTTGAAACCAAACCAGAGCCTGAGTGTTGCC	endogenous
CCL13	C-C motif chemokine ligand 13	NM_005408.2		CCAGAATTATATGAAACACCTGGGCCGGAAAGCTCACACCCTGAAGACTTGAACTCTGCTACCCCTACTGAAATCAAGCTGGAGTACGTGAAATGACTTT	endogenous
CCL14	C-C motif chemokine ligand 14	NM_032963.3		TTCATCACCAAAAGGGGCCATTCCGTCTGTACCAACCCCAGTGACAAGTGGGTCCAGGACTATATCAAGGACATGAAGGAGAACTGAGTGACCCAGAAGG	endogenous
CCL15	C-C motif chemokine ligand 15	NM_032965.3		TGCTAACACCTCCTGGTTGGAACTACAGGAATAGAACTGGAAAGGGAAAAAAGGCAGCATTCACCACATCCCAATCCTGAATCCAAGAGTCTAAGATAGT	endogenous
CCL16	C-C motif chemokine ligand 16	NM_004590.2		TTGTCCACGGTTAAAATTATTACAGCAAAGAATGGTCAACCCCAGCTCCTCAACTCCCAGTGATGACCAGGCTTTAGTGGAAGCCCTTGTTTACAGAAGA	endogenous
CCL17	C-C motif chemokine ligand 17	NM_002987.2		GCCTGGAGTACTTCAAGGGAGCCATTCCCCTTAGAAAGCTGAAGACGTGGTACCAGACATCTGAGGACTGCTCCAGGGATGCCATCGTTTTTGTAACTGT	endogenous
CCL18	C-C motif chemokine ligand 18	NM_002988.2		CCCCTTTCCCTTCAACTCTTCGTACATTCAATGCATGGATCAATCAGTGTGATTAGCTTTCTCAGCAGACATTGTGCCATATGTATCAAATGACAAATCT	endogenous
CCL19	C-C motif chemokine ligand 19	NM_006274.2		GACCTCAGCCAAGATGAAGCGCCGCAGCAGTTAACCTATGACCGTGCAGAGGGAGCCCGGAGTCCGAGTCAAGCATTGTGAATTATTACCTAACCTGGGG	endogenous
CCL2	C-C motif chemokine ligand 2	NM_002982.3		CATTCCCCAAGGGCTCGCTCAGCCAGATGCAATCAATGCCCCAGTCACCTGCTGTTATAACTTCACCAATAGGAAGATCTCAGTGCAGAGGCTCGCGAGC	endogenous
CCL20	C-C motif chemokine ligand 20	NM_004591.1		ATCTGTTCTTTGAGCTAAAAACCATGTGCTGTACCAAGAGTTTGCTCCTGGCTGCTTTGATGTCAGTGCTGCTACTCCACCTCTGCGGCGAATCAGAAGC	endogenous
CCL21	C-C motif chemokine ligand 21	NM_002989.2		CTCAAGTACAGCCAAAGGAAGATTCCCGCCAAGGTTGTCCGCAGCTACCGGAAGCAGGAACCAAGCTTAGGCTGCTCCATCCCAGCTATCCTGTTCTTGC	endogenous
CCL22	C-C motif chemokine ligand 22	NM_002990.3		CTCGCCCAAGCAGCTGGTAATTCCATTTCATGTATTAGATGTCCCCTGGCCCTCTGTCCCCTCTTAATAACCCTAGTCACAGTCTCCGCAGATTCTTGGG	endogenous
CCL23	C-C motif chemokine ligand 23	NM_005064.4		TTGCGTGAGAATGCTGAAGCTGGACACACGGATCAAGACCAGGAAGAATTGAACTTGTCAAGGTGAAGGGACACAAGTTGCCAGCCACCAACTTTCTTGC	endogenous
CCL24	C-C motif chemokine ligand 24	NM_002991.2		ATAGTAACCAGCCTTCTGTTCCTTGGTGTCTGTGCCCACCACATCATCCCTACGGGCTCTGTGGTCATCCCCTCTCCCTGCTGCATGTTCTTTGTTTCCA	endogenous
CCL25	C-C motif chemokine ligand 25	NM_005624.2		CAGGCCCTCATGCTGTAAAGAAGTTGAGTTCTGGAAACTCCAAGTTATCATCGTCCAAGTTTAGCAATCCCATCAGCAGCAGTAAGAGGAATGTCTCCCT	endogenous
CCL26	C-C motif chemokine ligand 26	NM_006072.4		GGAGTGACATATCCAAGACCTGCTGCTTCCAATACAGCCACAAGCCCCTTCCCTGGACCTGGGTGCGAAGCTATGAATTCACCAGTAACAGCTGCTCCCA	endogenous
CCL27	C-C motif chemokine ligand 27	NM_006664.2		CCCCAGCCTGTCACAGTGGTTTGAGCACCAAGAGAGAAAGCTCCATGGGACTCTGCCCAAGCTGAATTTTGGGATGCTAAGGAAAATGGGCTGAAGCCCC	endogenous
CCL28	C-C motif chemokine ligand 28	NM_148672.2		CACATCAGGGGAAACACGAAACATACGGCCATAAAACTCCTTATTAGAGAGTCTACAGATAAATCTACAGAGACAATTCCTCAAGTGGACTTGGCCATGA	endogenous
CCL3/L1	C-C motif chemokine ligand 3	NM_002983.2		CAGTTCTCTGCATCACTTGCTGCTGACACGCCGACCGCCTGCTGCTTCAGCTACACCTCCCGGCAGATTCCACAGAATTTCATAGCTGACTACTTTGAGA	endogenous
CCL4/L1	C-C motif chemokine ligand 4	NM_002984.2		GAAGCTTCCTCGCAACTTTGTGGTAGATTACTATGAGACCAGCAGCCTCTGCTCCCAGCCAGCTGTGGTATTCCAAACCAAAAGAAGCAAGCAAGTCTGT	endogenous
CCL5	C-C motif chemokine ligand 5	NM_002985.2		AGTGTGTGCCAACCCAGAGAAGAAATGGGTTCGGGAGTACATCAACTCTTTGGAGATGAGCTAGGATGGAGAGTCCTTGAACCTGAACTTACACAAATTT	endogenous
CCL7	C-C motif chemokine ligand 7	NM_006273.2		CAGCCCCCAGGGGCTTGCTCAGCCAGTTGGGATTAATACTTCAACTACCTGCTGCTACAGATTTATCAATAAGAAAATCCCTAAGCAGAGGCTGGAGAGC	endogenous
CCL8	C-C motif chemokine ligand 8	NM_005623.2		AAGGAGAGATGGGTCAGGGATTCCATGAAGCATCTGGACCAAATATTTCAAAATCTGAAGCCATGAGCCTTCATACATGGACTGAGAGTCAGAGCTTGAA	endogenous
CCNC	cyclin C	NM_005190.3		ATCATCCTTATAGACCTTTGCTCCAGTATGTGCAGGACATGGGCCAAGAAGACATGTTGCTTCCCCTTGCATGGAGGATAGTGAATGATACCTACAGAAC	endogenous
CCR2	C-C motif chemokine receptor 2	NM_001123041.2		TCTGATCTGCTTTTTCTTATTACTCTCCCATTGTGGGCTCACTCTGCTGCAAATGAGTGGGTCTTTGGGAATGCAATGTGCAAATTATTCACAGGGCTGT	endogenous
CCR4	C-C motif chemokine receptor 4	NM_005508.4		TCCCTTCCTGGCTTTCTGTTCAGCACTTGTTATACTGAGCGCAACCATACCTACTGCAAAACCAAGTACTCTCTCAACTCCACGACGTGGAAGGTTCTCA	endogenous
CCR5	C-C motif chemokine receptor 5 (gene/pseudogene)	NM_000579.1		TAGGAACATACTTCAGCTCACACATGAGATCTAGGTGAGGATTGATTACCTAGTAGTCATTTCATGGGTTGTTGGGAGGATTCTATGAGGCAACCACAGG	endogenous
CCR6	C-C motif chemokine receptor 6	NM_031409.2		CTTTAACTGCGGGATGCTGCTCCTGACTTGCATTAGCATGGACCGGTACATCGCCATTGTACAGGCGACTAAGTCATTCCGGCTCCGATCCAGAACACTA	endogenous
CCR7	C-C motif chemokine receptor 7	NM_001838.2		TTCCGAAAACCAGGCCTTATCTCCAAGACCAGAGATAGTGGGGAGACTTCTTGGCTTGGTGAGGAAAAGCGGACATCAGCTGGTCAAACAAACTCTCTGA	endogenous
CCR8	C-C motif chemokine receptor 8	NM_005201.2		TTGCCTCCTGTTTGTATTCAGTCTTCTGGGAAACAGCCTGGTCATCCTGGTCCTTGTGGTCTGCAAGAAGCTGAGGAGCATCACAGATGTATACCTCTTG	endogenous
CD14	CD14 molecule	NM_000591.2		GCCCAAGCACACTCGCCTGCCTTTTCCTGCGAACAGGTTCGCGCCTTCCCGGCCCTTACCAGCCTAGACCTGTCTGACAATCCTGGACTGGGCGAACGCG	endogenous
CD160	CD160 molecule	NM_007053.3		AACAAAGACAACACCTTGAGTTCAGCCATAATGAAGGCACTCTCAGTTCAGGCTTCCTACAAGAAAAGGTCTGGGTAATGCTGGTCACCAGCCTTGTGGC	endogenous
CD163	CD163 molecule	NM_004244.4		CATCTGTGATTCGGACTTCTCTCTGGAAGCTGCCAGCGTTCTATGCAGGGAATTACAGTGTGGCACAGTTGTCTCTATCCTGGGGGGAGCTCACTTTGGA	endogenous
CD19	CD19 molecule	XM_011545981.1		CACCCCAAGGGGCCTAAGTCATTGCTGAGCCTAGAGCTGAAGGACGATCGCCCGGCCAGAGATATGTGGGTAATGGAGACGGGTCTGTTGTTGCCCCGGG	endogenous
CD1A	CD1a molecule	NM_001763.2		CCTGTTTTAGATATCCCTTACTCCAGAGGGCCTTCCCTGACTTACAAGTGGGAAGCAGTCTCTTCCTGGTCTGAACTCCCGCCACATTTTAGCCGTACTT	endogenous
CD1D	CD1d molecule	NM_001766.3		GGCGTGCTTGCTGTTCCTCCTCATTGTGGGCTTTACCTCCCGGTTTAAGAGGCAAACTTCCTATCAGGGCGTCCTGTGACTCGCCTTGCCACATCTGTGT	endogenous
CD200	CD200 molecule	NM_005944.5		CCCTCGGTCAGGGATTGAAAATAGTACAGTGACTCTGTCTCACCCAAATGGGACCACGTCTGTTACCAGCATCCTCCATATCAAAGACCCTAAGAATCAG	endogenous
CD209	CD209 molecule	NM_001144899.1		TAGAGCTTGTTTTTCTGGCCCATCCTTGGAGCTTTATGAGTGAGCTGGTGTGGGATGCCTTTGGGGGTGGACTTGTGTTCCAAGAATCCACTCTCTCTTC	endogenous
CD22	CD22 molecule	NM_001771.2		TTTTCCAGAAGATGAGGGGATTCATTACTCAGAGCTGATCCAGTTTGGGGTCGGGGAGCGGCCTCAGGCACAAGAAAATGTGGACTATGTGATCCTCAAA	endogenous
CD244	CD244 molecule	NM_001166663.1		CTCCAGGCGCTGGGGCTTTCTCAGTGGCCTTGTCAGCTCACAGCAGGCGTTAACAGCCTCTAATTGAGGAAACTGTGGCTGGACAGGTTGCAAGGCAGTT	endogenous
CD247	CD247 molecule	NM_198053.2		CCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGA	endogenous
CD27	CD27 molecule	NM_001242.4		GTCAGGGCCCTTTCCTGTGTACACGTGACAGAGTGCCTTTTCGAGACTGGCAGGGACGAGGACAAATATGGATGAGGTGGAGAGTGGGAAGCAGGAGCCC	endogenous
CD274	CD274 molecule	NM_014143.3		AGCTTCCCGAGGCTCCGCACCAGCCGCGCTTCTGTCCGCCTGCAGGGCATTCCAGAAAGATGAGGATATTTGCTGTCTTTATATTCATGACCTACTGGCA	endogenous
CD276	CD276 molecule	NM_001024736.1		ACATTTCTTAGGGACACAGTACACTGACCACATCACCACCCTCTTCTTCCAGTGCTGCGTGGACCATCTGGCTGCCTTTTTTCTCCAAAAGATGCAATAT	endogenous
CD28	CD28 molecule	NM_001243078.1		GCTGCTCCTGTACCTTGGAGGTCCATTCACATGGGAAAGTATTTTGGAATGTGTCTTTTGAAGAGAGCATCAGAGTTCTTAAGGGACTGGGTAAGGCCTG	endogenous
CD300C	CD300c molecule	XM_017024034.1		ATGACTGCCAGGGCCTGGGCCTCGTGGCGGTCTTCAGCTCTGCTCCTCCTGCTTGTCCCAGGCTATTTTCCTCTGAGCCACCCCATGACCGTGGCGGGCC	endogenous
CD300E	CD300e molecule	NM_181449.1		ATGATGCTGGATCTTACTGGTGCAAAATTCAGACAGTGTGGGTCCTGGATTCATGGTCACGCGATCCCTCGGACCTGGTTAGGGTGTATGTTTCCCCAGC	endogenous
CD300LF	CD300 molecule like family member f	NM_139018.3		TTCCTCTGCCCAGGTTGACCAGGTGGAAGTGGAATATGTCACCATGGCTTCCTTGCCGAAGGAGGACATTTCCTATGCATCTCTGACCTTGGGTGCTGAG	endogenous
CD33	CD33 molecule	NM_001177608.1		GCCTCATCTTCTTCATAGTGAAGACCCACAGGAGGAAAGCAGCCAGGACAGCAGTGGGCAGGAATGACACCCACCCTACCACAGGGTCAGCCTCCCCGGT	endogenous
CD38	CD38 molecule	NM_001775.2		CCTTGACTCCTTGTGGTTTATGTCATCATACATGACTCAGCATACCTGCTGGTGCAGAGCTGAAGATTTTGGAGGGTCCTCCACAATAAGGTCAATGCCA	endogenous
CD3D	CD3d molecule	NM_000732.4		TATCTACTGGATGAGTTCCGCTGGGAGATGGAACATAGCACGTTTCTCTCTGGCCTGGTACTGGCTACCCTTCTCTCGCAAGTGAGCCCCTTCAAGATAC	endogenous
CD3E	CD3e molecule	NM_000733.2		AAGTAACAGTCCCATGAAACAAAGATGCAGTCGGGCACTCACTGGAGAGTTCTGGGCCTCTGCCTCTTATCAGTTGGCGTTTGGGGGCAAGATGGTAATG	endogenous
CD3G	CD3g molecule	NM_000073.2		GAACTAAATGCAGCCACCATATCTGGCTTTCTCTTTGCTGAAATCGTCAGCATTTTCGTCCTTGCTGTTGGGGTCTACTTCATTGCTGGACAGGATGGAG	endogenous
CD4	CD4 molecule	NM_000616.4		TGGCAGGCGGAGAGGGCTTCCTCCTCCAAGTCTTGGATCACCTTTGACCTGAAGAACAAGGAAGTGTCTGTAAAACGGGTTACCCAGGACCCTAAGCTCC	endogenous
CD40	CD40 molecule	NM_001250.4		GTGCCAGCCAGGACAGAAACTGGTGAGTGACTGCACAGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAGACACCTGGAACAGA	endogenous
CD40LG	CD40 ligand	NM_000074.2		GCATTTGATTTATCAGTGAAGATGCAGAAGGGAAATGGGGAGCCTCAGCTCACATTCAGTTATGGTTGACTCTGGGTTCCTATGGCCTTGTTGGAGGGGG	endogenous
CD45R0	protein tyrosine phosphatase, receptor type C, isoform R0	NM_080921.3		TTTCTGGACACAGAAGTATTTGTGACAGGGCAAAGCCCAACACCTTCCCCCACTGATGCCTACCTTAATGCCTCTGAAACAACCACTCTGAGCCCTTCTG	endogenous
CD45RA	protein tyrosine phosphatase, receptor type C, isoform RA	NM_002838.4		TTTCTGGACACAGAAGTATTTGTGACAGGGCAAAGCCCAACACCTTCCCCCACTGGATTGACTACAGCAAAGATGCCCAGTGTTCCACTTTCAAGTGACC	endogenous
CD6	CD6 molecule	NM_001254751.1		AACCCTGGACACTGCATTACAGACCCGCCATCCCTGGGCCCTCAGTATCACCCGAGGAGCAACAGTGAGTCGAGCACCTCTTCAGGGGAGGATTACTGCA	endogenous
CD68	CD68 molecule	NM_001251.2		ACCGGTCCATCTTGCTGCCTCTCATCATCGGCCTGATCCTTCTTGGCCTCCTCGCCCTGGTGCTTATTGCTTTCTGCATCATCCGGAGACGCCCATCCGC	endogenous
CD69	CD69 molecule	NM_001781.1		AGGACATGAACTTTCTAAAACGATACGCAGGTAGAGAGGAACACTGGGTTGGACTGAAAAAGGAACCTGGTCACCCATGGAAGTGGTCAAATGGCAAAGA	endogenous
CD7	CD7 molecule	NM_006137.6		CCTACACCTGCCAGGCCATCACGGAGGTCAATGTCTACGGCTCCGGCACCCTGGTCCTGGTGACAGAGGAACAGTCCCAAGGATGGCACAGATGCTCGGA	endogenous
CD80	CD80 molecule	NM_005191.3		GATATCACTAATAACCTCTCCATTGTGATCCTGGCTCTGCGCCCATCTGACGAGGGCACATACGAGTGTGTTGTTCTGAAGTATGAAAAAGACGCTTTCA	endogenous
CD84	CD84 molecule	NM_001184879.1		TCTGCTAGAACAGTGCCGTGCTTTTCCACAGAAGGTTAGACCCTGAAAGAGATGGCTCAGCACCACCTATGGATCTTGCTCCTTTGCCTGCAAACCTGGC	endogenous
CD86	CD86 molecule	NM_175862.3		CCAGCTCTGCTCCGTATGCCAAGAGGAGACTTTAATTCTCTTACTGCTTCTTTTCACTTCAGAGCACACTTATGGGCCAAGCCCAGCTTAATGGCTCATG	endogenous
CD8A	CD8a molecule	NM_001768.5		GCTCAGGGCTCTTTCCTCCACACCATTCAGGTCTTTCTTTCCGAGGCCCCTGTCTCAGGGTGAGGTGCTTGAGTCTCCAACGGCAAGGGAACAAGTACTT	endogenous
CD8B	CD8b molecule	NM_172099.2		TCAGCTGAGTGTGGTTGATTTCCTTCCCACCACTGCCCAGCCCACCAAGAAGTCCACCCTCAAGAAGAGAGTGTGCCGGTTACCCAGGCCAGAGACCCAG	endogenous
CD9	CD9 molecule	NM_001769.2		ATATTCGCCATTGAAATAGCTGCGGCCATCTGGGGATATTCCCACAAGGATGAGGTGATTAAGGAAGTCCAGGAGTTTTACAAGGACACCTACAACAAGC	endogenous
CD96	CD96 molecule	NM_005816.4		TCACTTGTGACTTTCACAGAAACTCCTGAGAATGGGTCAAAATGGACTCTGCACTTAAGGAATATGTCTTGTTCAGTCAGTGGAAGGTACGAGTGTATGC	endogenous
CD99	CD99 molecule (Xg blood group)	NM_002414.4		ACGCCCCAGGCGTGATCCCCGGGATTGTGGGGGCTGTCGTGGTCGCCGTGGCTGGAGCCATCTCTAGCTTCATTGCTTACCAGAAAAAGAAGCTATGCTT	endogenous
CDC26	cell division cycle 26	NM_139286.3		AAGATCTGTTTGGACGCGGAGGATAATCCTGTGAATTGCTAATAGTTCACTGGGTTTGGCCCTTAGTGTTGACTTCAGTATGCTGAGACGGAAACCAACA	endogenous
CDC42	cell division cycle 42	NM_001039802.1		ACCGACTGTTTTTGACAACTATGCAGTCACAGTTATGATTGGTGGAGAACCATATACTCTTGGACTTTTTGATACTGCAGGGCAAGAGGATTATGACAGA	endogenous
CDKN1A	cyclin dependent kinase inhibitor 1A	NM_000389.2		CATGTGTCCTGGTTCCCGTTTCTCCACCTAGACTGTAAACCTCTCGAGGGCAGGGACCACACCCTGTACTGTTCTGTGTCTTTCACAGCTCCTCCCACAA	endogenous
CEACAM1	carcinoembryonic antigen related cell adhesion molecule 1	NM_001712.3		AGAGGGAGGGGTTATAGCTTCAGGAGGGAACCAGCTTCTGATAAACACAATCTGCTAGGAACTTGGGAAAGGAATCAGAGAGCTGCCCTTCAGCGATTAT	endogenous
CEACAM3	carcinoembryonic antigen related cell adhesion molecule 3	NM_001815.3		GCCTTCCTGTGGGGGCCGTCGCCGGCATCGTGACCGGGGTCCTGGTCGGAGTGGCGCTGGTGGCCGCGCTGGTGTGTTTCCTGCTCCTTGCCAAAACTGG	endogenous
CHMP3	charged multivesicular body protein 3	NM_016079.3		TGCCTGGGCGCGGGGAACTGAAAGCCGGAAGGGGCAAGACGGGTTCAGTTCGTCATGGGGCTGTTTGGAAAGACCCAGGAGAAGCCGCCCAAAGAACTGG	endogenous
CHMP4A	charged multivesicular body protein 4A	NM_014169.2		ACAAACTGACGGGACATTATCCACCCTGGAGTTTCAGCGTGAGGCCATTGAGAATGCCACTACCAATGCAGAAGTCCTTCGTACCATGGAGCTTGCTGCC	endogenous
CIITA	class II major histocompatibility complex transactivator	NM_000246.3		CTTTCCCCAAACTGGTGCGGATCCTCACGGCCTTTTCCTCCCTGCAGCATCTGGACCTGGATGCGCTGAGTGAGAACAAGATCGGGGACGAGGGTGTCTC	endogenous
CISH	cytokine inducible SH2 containing protein	NM_145071.2		CACCAATGTACGCATTGAGTATGCCGACTCCAGCTTCCGTCTGGACTCCAACTGCTTGTCCAGGCCACGCATCCTGGCCTTTCCGGATGTGGTCAGCCTT	endogenous
CKAP5	cytoskeleton associated protein 5	NM_014756.2		TTGCTAAAGCCCTTTTGTGCTGCACTACTTAAGCACATCAATGATTCTGCTCCTGAAGTCAGAGATGCCGCATTTGAAGCATTGGGTACTGCTTTGAAGG	endogenous
CLCF1	cardiotrophin like cytokine factor 1	NM_013246.2		GATGGGTGTTGCTCCCTTATCCCCAAATCACTCTATACATCCAATTCAGGAAACAAACATGGTGGCAATTCTACACAAAAAGAGATGAGATTAACAGTGC	endogenous
CLDN1	claudin 1	NM_021101.3		GCAAAGTCTTTGACTCCTTGCTGAATCTGAGCAGCACATTGCAAGCAACCCGTGCCTTGATGGTGGTTGGCATCCTCCTGGGAGTGATAGCAATCTTTGT	endogenous
CLDN23	claudin 23	NM_194284.2		AGAAGCCAAGAGGAGAACAAAGGTCCTAATGCTGTACTATTCCACCCTTTGGACGCCTCATCCAGGACGCAGAGGACTCTAGGTTTAACATTTTGTACAA	endogenous
CLDN3	claudin 3	NM_001306.3		TGCTCACCCTCGTGCCGGTGTCCTGGTCGGCCAACACCATTATCCGGGACTTCTACAACCCCGTGGTGCCCGAGGCGCAGAAGCGCGAGATGGGCGCGGG	endogenous
CLDN4	claudin 4	NM_001305.3		GGGAGCTGGCTTCTGCTGGCCAGGATAGCTTAACCCTGACTTTGGGATCTGCCTGCATCGGCGTTGGCCACTGTCCCCATTTACATTTTCCCCACTCTGT	endogenous
CLDN7	claudin 7	NM_001307.3		AATTTTGTCTGGAACCACCCTCCCGGCGTATCCTACTCCCTGTGCCGCGAGGCCATCGCTTCACTGGAGGGGTCGATTTGTGTGTAGTTTGGTGACAAGA	endogenous
CMIP	c-Maf inducing protein	NM_198390.2		GGGAGGGGTTTGGGGGTGGGCTGGGGGGTGGGGGACCCTTTGTGGATTTTCTTTGCCTTTGTGTTTGATGCCGTCGTGTGGGAAAAGTCAACTCCGATGC	endogenous
CMKLR1	chemerin chemokine-like receptor 1	NM_004072.1		CAACGTCTTCCTCCCAATCCATATCACCTATGCCGCCATGGACTACCACTGGGTTTTCGGGACAGCCATGTGCAAGATCAGCAACTTCCTTCTCATCCAC	endogenous
COLEC12	collectin subfamily member 12	NM_130386.2		ACACAAGCCAGGCTATCCAGCGAATCAAGAACGACTTTCAAAATCTGCAGCAGGTTTTTCTTCAAGCCAAGAAGGACACGGATTGGCTGAAGGAGAAAGT	endogenous
COX16	cytochrome c oxidase assembly factor COX16	NM_001204090.1		AATAACCAAGGAAAAGGAAGTGAGTTAAGGACGTACTCGTCTTGGTGAGAGCGTGAGCTGCTGAGATTTGGGAGTCTGCGCTAGGCCCGCTTGGAGTTCT	endogenous
COX19	cytochrome c oxidase assembly factor COX19	NM_001031617.2		GGAAAAAACTAGAAATACATCGTGGATGATGAGAGCCAGGTGTATTGAGCTCCTGCTTTTCTAACGTACAAAGGTAACTGGATAGAGAAACGGAGTGATC	endogenous
COX4I1	cytochrome c oxidase subunit 4I1	NM_001318797.1		GGCAGAATGTTGGCTACCAGGGTATTTAGCCTAGTTGGCAAGCGAGCAATTTCCACCTCTGTGTGTGTACGAGCTCATGTGTTGTGAAGAGCGAAGACTT	endogenous
COX5B	cytochrome c oxidase subunit 5B	NM_001862.2		CAGGCACCAGGGAAGACCCTAATTTAGTCCCCTCCATCTCCAACAAGAGAATAGTAGGCTGCATCTGTGAAGAGGACAATACCAGCGTCGTCTGGTTTTG	endogenous
COX6B1	cytochrome c oxidase subunit 6B1	NM_001863.4		AACCAGACTAGAAACTGCTGGCAGAACTACCTGGACTTCCACCGCTGTCAGAAGGCAATGACCGCTAAAGGAGGCGATATCTCTGTGTGCGAATGGTACC	endogenous
COX6C	cytochrome c oxidase subunit 6C	NM_004374.2		GAAGTTTTGCCAAAACCTCGGATGCGTGGCCTTCTGGCCAGGCGTCTGCGAAATCATATGGCTGTAGCATTCGTGCTATCCCTGGGGGTTGCAGCTTTGT	endogenous
COX7A2	cytochrome c oxidase subunit 7A2	NM_001865.3		AGGAGGATGATGAAATTCCACTGTATCTAAAGGGTGGGGTAGCTGATGCCCTCCTGTATAGAGCCACCATGATTCTTACAGTTGGTGGAACAGCATATGC	endogenous
COX7B	cytochrome c oxidase subunit 7B	NM_001866.2		CAGAGCCACCAGAAACGTACACCTGATTTTCATGACAAATACGGTAATGCTGTATTAGCTAGTGGAGCCACTTTCTGTATTGTTACATGGACATATGTAG	endogenous
COX7C	cytochrome c oxidase subunit 7C	NM_001867.2		TCTGCGCCTTTCGCAGAGCTTCCAGCAGCGGTATGTTGGGCCAGAGCATCCGGAGGTTCACAACCTCTGTGGTCCGTAGGAGCCACTATGAGGAGGGCCC	endogenous
CPA3	carboxypeptidase A3	NM_001870.2		ACCCACCACGTAGCTGCTAATATGATGGTGGATTTCCGAGTTAGTGAGAAGGAATCCCAAGCCATCCAGTCTGCCTTGGATCAAAATAAAATGCACTATG	endogenous
CPT1A	carnitine palmitoyltransferase 1A	NM_001876.3		CAGGCCTATTTTGGACGTGGGAAAAATAAGCAGTCTCTTGATGCTGTGGAGAAAGCAGCGTTCTTCGTGACGTTAGATGAAACTGAAGAAGGATACAGAA	endogenous
CPT1B	carnitine palmitoyltransferase 1B	NM_004377.3		AGTGGGACATTCCAAAACAGTGCCAGGCGGTCATCGAGAGTTCCTACCAGGTGGCCAAGGCGTTGGCAGACGACGTGGAGTTGTACTGCTTCCAGTTCCT	endogenous
CREB1	cAMP responsive element binding protein 1	NM_004379.3		TTTTGAATGACTTATCTTCTGATGCACCAGGAGTGCCAAGGATTGAAGAAGAGAAGTCTGAAGAGGAGACTTCAGCACCTGCCATCACCACTGTAACGGT	endogenous
CRLF2	cytokine receptor like factor 2	NM_022148.3		GGAGAGTGAAGAAGTTTCTCATTCCCAGCGTGCCAGACCCGAAATCCATCTTCCCCGGGCTCTTTGAGATACACCAAGGGAACTTCCAGGAGTGGATCAC	endogenous
CS	citrate synthase	NM_004077.2		CATATGCACAGGGTATCAGCCGAACCAAGTACTGGGAGTTGATTTATGAAGACTCTATGGATCTAATCGCAAAGCTACCTTGTGTTGCAGCAAAGATCTA	endogenous
CSF2	colony stimulating factor 2	NM_000758.2		AGATGAGGCTGGCCAAGCCGGGGAGCTGCTCTCTCATGAAACAAGAGCTAGAAACTCAGGATGGTCATCTTGGAGGGACCAAGGGGTGGGCCACAGCCAT	endogenous
CSF2RA	colony stimulating factor 2 receptor alpha subunit	NM_006140.3		AGAAGGAGGGAGATCCGGTGTCCTTATTACATACAAGACTCAGGAACCCATGTGGGATGTCACCTGGATAACCTGTCAGGATTAACGTCTCGCAATTACT	endogenous
CSF3	colony stimulating factor 3	NM_000759.3		CCTGCATTTCTGAGTTTCATTCTCCTGCCTGTAGCAGTGAGAAAAAGCTCCTGTCCTCCCATCCCCTGGACTGGGAGGTAGATAGGTAAATACCAAGTAT	endogenous
CSF3R	colony stimulating factor 3 receptor	NM_000760.3		AGGCCCTTTCAGCTCTATGAGATCATCGTGACTCCCTTGTACCAGGACACCATGGGACCCTCCCAGCATGTCTATGCCTACTCTCAAGAAATGGCTCCCT	endogenous
CTLA4	cytotoxic T-lymphocyte associated protein 4	NM_005214.3		AGTCTGTGCGGCAACCTACATGATGGGGAATGAGTTGACCTTCCTAGATGATTCCATCTGCACGGGCACCTCCAGTGGAAATCAAGTGAACCTCACTATC	endogenous
CTNNA1	catenin alpha 1	NM_001903.2		TCAGAGATGGACAACTATGAGCCAGGAGTCTACACAGAGAAGGTTCTGGAAGCCACTAAGCTGCTCTCCAACACAGTCATGCCACGTTTTACTGAGCAAG	endogenous
CTNNB1	catenin beta 1	NM_001098210.1		TCTTGCCCTTTGTCCCGCAAATCATGCACCTTTGCGTGAGCAGGGTGCCATTCCACGACTAGTTCAGTTGCTTGTTCGTGCACATCAGGATACCCAGCGC	endogenous
CTNND1	catenin delta 1	NM_001331.2		AAGAAGAGCAGGAAAGATCCCGAAAGGAGGAAGAGGTGGCGAAAAATCAACTGCCCTGCTGGATTTGTCTTTCTCAGCACCTTGGCGAAGCCTTGGGTTT	endogenous
CTSD	cathepsin D	NM_001909.3		GAAGCCGGCGGCCCAAGCCCGACTTGCTGTTTTGTTCTGTGGTTTTCCCCTCCCTGGGTTCAGAAATGCTGCCTGCCTGTCTGTCTCTCCATCTGTTTGG	endogenous
CTSW	cathepsin W	NM_001335.3		TGCACCGAGGGAGCAATACCTGTGGCATCACCAAGTTCCCGCTCACTGCCCGTGTGCAGAAACCGGATATGAAGCCCCGAGTCTCCTGCCCTCCCTGAAC	endogenous
CX3CL1	C-X3-C motif chemokine ligand 1	NM_002996.3		CCCCGGAGCTGTGGTAGTAATTCATATGTCCTGGTGCCCGTGTGAACTCCTCTGGCCTGTGTCTAGTTGTTTGATTCAGACAGCTGCCTGGGATCCCTCA	endogenous
CX3CR1	C-X3-C motif chemokine receptor 1	NM_001337.3		GGGCGCTCAGTCCACGTTGATTTCTCCTCATCTGAATCACAAAGGAGCAGGCATGGAAGTGTTCTGAGCAGCAATTTTACTTACCACACGAGTGATGGAG	endogenous
CXCL1	C-X-C motif chemokine ligand 1	NM_001511.1		TATGTTAATATTTCTGAGGAGCCTGCAACATGCCAGCCACTGTGATAGAGGCTGGCGGATCCAAGCAAATGGCCAATGAGATCATTGTGAAGGCAGGGGA	endogenous
CXCL10	C-X-C motif chemokine ligand 10	NM_001565.2		GCCATAATTGTTCTTAGTTTGCAGTTACACTAAAAGGTGACCAATGATGGTCACCAAATCAGCTGCTACTACTCCTGTAGGAAGGTTAATGTTCATCATC	endogenous
CXCL11	C-X-C motif chemokine ligand 11	NM_005409.4		TTCAAAAGAGGACGCTGTCTTTGCATAGGCCCTGGGGTAAAAGCAGTGAAAGTGGCAGATATTGAGAAAGCCTCCATAATGTACCCAAGTAACAACTGTG	endogenous
CXCL12	C-X-C motif chemokine ligand 12	NM_199168.3		CCGCCCGCCCGCCCGCCCGCGCCATGAACGCCAAGGTCGTGGTCGTGCTGGTCCTCGTGCTGACCGCGCTCTGCCTCAGCGACGGGAAGCCCGTCAGCCT	endogenous
CXCL13	C-X-C motif chemokine ligand 13	NM_006419.2		AGACGCTTCATTGATCGAATTCAAATCTTGCCCCGTGGGAATGGTTGTCCAAGAAAAGAAATCATAGTCTGGAAGAAGAACAAGTCAATTGTGTGTGTGG	endogenous
CXCL14	C-X-C motif chemokine ligand 14	NM_004887.4		CCATACGTCACTATACATCTGAGCTTTATAAGCGCCCGGGAGGAACAATGAGCTTGGTGGACACATTTCATTGCAGTGTTGCTCCATTCCTAGCTTGGGA	endogenous
CXCL16	C-X-C motif chemokine ligand 16	NM_001100812.1		CCATGGGTTCAGGAATTGATGAGCTGTCTTGATCTCAAAGAATGTGGACATGCTTACTCGGGGATTGTGGCCCACCAGAAGCATTTACTTCCTACCAGCC	endogenous
CXCL2	C-X-C motif chemokine ligand 2	NM_002089.3		ATCACATGTCAGCCACTGTGATAGAGGCTGAGGAATCCAAGAAAATGGCCAGTGAGATCAATGTGACGGCAGGGAAATGTATGTGTGTCTATTTTGTAAC	endogenous
CXCL3	C-X-C motif chemokine ligand 3	NM_002090.2		TCCCTGCCCTTACCAGAGCTGAAAATGAAAAAGAGAACAGCAGCTTTCTAGGGACAGCTGGAAAGGACTTAATGTGTTTGACTATTTCTTACGAGGGTTC	endogenous
CXCL5	C-X-C motif chemokine ligand 5	NM_002994.3		AGAGAGCTGCGTTGCGTTTGTTTACAGACCACGCAAGGAGTTCATCCCAAAATGATCAGTAATCTGCAAGTGTTCGCCATAGGCCCACAGTGCTCCAAGG	endogenous
CXCL6	C-X-C motif chemokine ligand 6	NM_002993.3		AGTAACAAAAAAGACCATGCATCATAAAATTGCCCAGTCTTCAGCGGAGCAGTTTTCTGGAGATCCCTGGACCCAGTAAGAATAAGAAGGAAGGGTTGGT	endogenous
CXCL8	C-X-C motif chemokine ligand 8	NM_000584.2		ACAGCAGAGCACACAAGCTTCTAGGACAAGAGCCAGGAAGAAACCACCGGAAGGAACCATCTCACTGTGTGTAAACATGACTTCCAAGCTGGCCGTGGCT	endogenous
CXCL9	C-X-C motif chemokine ligand 9	NM_002416.1		CACCATCTCCCATGAAGAAAGGGAACGGTGAAGTACTAAGCGCTAGAGGAAGCAGCCAAGTCGGTTAGTGGAAGCATGATTGGTGCCCAGTTAGCCTCTG	endogenous
CXCR3	C-X-C motif chemokine receptor 3	NM_001504.1		GTGAGTGACCACCAAGTGCTAAATGACGCCGAGGTTGCCGCCCTCCTGGAGAACTTCAGCTCTTCCTATGACTATGGAGAAAACGAGAGTGACTCGTGCT	endogenous
CXCR4	C-X-C motif chemokine receptor 4	NM_003467.2		ATTGATGTGTGTCTAGGCAGGACCTGTGGCCAAGTTCTTAGTTGCTGTATGTCTCGTGGTAGGACTGTAGAAAAGGGAACTGAACATTCCAGAGCGTGTA	endogenous
CXCR5	C-X-C motif chemokine receptor 5	NM_001716.3		ACGTCCCTTTTTTCTCTGAGTATCTCCTCGCAAGCTGGGTAATCGATGGGGGAGTCTGAAGCAGATGCAAAGAGGCAAGAGGCTGGATTTTGAATTTTCT	endogenous
CXCR6	C-X-C motif chemokine receptor 6	NM_006564.1		TTACCATGAAGACTATGGGTTCAGCAGTTTCAATGACAGCAGCCAGGAGGAGCATCAAGACTTCCTGCAGTTCAGCAAGGTCTTTCTGCCCTGCATGTAC	endogenous
CYBB	cytochrome b-245 beta chain	NM_000397.3		TTTGAAGCATGAAAAAAGAGGGTTGGAGGTGGAGAATTAACCTCCTGCCATGACTCTGGCTCATCTAGTCCTGCTCCTTGTGCTATAAAATAAATGCAGA	endogenous
DAP3	death associated protein 3	NM_004632.3		CACAGATGCAGTTGGAATTGTGCTGAAAGAGCTAAAGAGGCAAAGTTCTTTGGGTATGTTTCACCTCCTAGTGGCCGTGGATGGAATCAATGCTCTTTGG	endogenous
DDIT4	DNA damage inducible transcript 4	NM_019058.2		CCCATTCAAGCGGCAGGACGCACTTGTCTTAGCAGTTCTCGCTGACCGCGCTAGCTGCGGCTTCTACGCTCCGGCACTCTGAGTTCATCAGCAAACGCCC	endogenous
DECR1	2,4-dienoyl-CoA reductase 1	NM_001359.1		GAATGCGATTCAATGTGATTCAACCAGGGCCTATAAAAACCAAAGGTGCCTTTAGCCGTCTGGACCCAACTGGAACATTTGAGAAAGAAATGATTGGCAG	endogenous
DGLUCY	D-glutamate cyclase	NM_001102369.2		GAGCCAAGTTACACCCTGTTTAACCCTGCCTTCAAAGGGACGACTCTGTAAGATTCTCTGCTACTTATTCAAGTTGACACGATGCCCTTCACACTCCACC	endogenous
DHFR2	dihydrofolate reductase 2	NM_001195643.1		GAGGCACGTAAAAAAATTTGAAGAAGGGAATTTCGCGGCATTCTTGGCCTGGCTTCCTGGCGTAGCCAGCAAGTTCGGAGGTGTTAACCGCTGCTGTCAT	endogenous
DHRS4	dehydrogenase/reductase 4	NM_021004.2		ACTGTTCACCTCATCAAATCAGTTCTGCCCTGTGAAAAGATCCAGCCTTCCCTGCCGTCAAGGTGGCGTCTTACTCGGGATTTCTGCTGTTGTTGTGGCC	endogenous
DIABLO	diablo IAP-binding mitochondrial protein	NM_138930.2		GGCGAGACGCCTTTGTGAGCTGTGAGTGCCTCCTGTGGTCTCAGGCTTGCGCTGGACCTGGTTCTTAGCCCTTGGGCACTGCACCCTGTTTAACATTTCA	endogenous
DLL1	delta like canonical Notch ligand 1	NM_005618.3		ACCAGTCGGTGTACGTCATATCCGAGGAGAAGGATGAGTGCGTCATAGCAACTGAGGTGTAAAATGGAAGTGAGATGGCAAGACTCCCGTTTCTCTTAAA	endogenous
DOCK2	dedicator of cytokinesis 2	NM_004946.2		AATACAAAACTACCATCCTTTTGCAGGTGGCGGCTTTGAAATACATCCCATCTGTCCTGCATGATGTAGAAATGGTCTTTGATGCGAAGTTACTCAGCCA	endogenous
DUSP1	dual specificity phosphatase 1	NM_004417.2		TCAAGAATGCTGGAGGAAGGGTGTTTGTCCACTGCCAGGCAGGCATTTCCCGGTCAGCCACCATCTGCCTTGCTTACCTTATGAGGACTAATCGAGTCAA	endogenous
DVL2	dishevelled segment polarity protein 2	NM_004422.2		GAGGACGTCATCCTTCAGCAGCGTCACAGATTCCACAATGTCTCTCAATATCATCACAGTCACGCTAAACATGGAGAAGTACAACTTCCTGGGTATCTCC	endogenous
EBI3	Epstein-Barr virus induced 3	NM_005755.2		CCGGGCAACCTCAGATGACCGACTTTTCCCTTTGAGCCTCAGTTTCTCTAGCTGAGAAATGGAGATGTACTACTCTCTCCTTTACCTTTACCTTTACCAC	endogenous
EGF	epidermal growth factor	NM_001963.4		GGAGTGAAGGCTCTGTTGGAGACATCAGAGAAAATAACAGCTGTGTCATTGGATGTGCTTGATAAGCGGCTGTTTTGGATTCAGTACAACAGAGAAGGAA	endogenous
EGR1	early growth response 1	NM_001964.2		GAGGCATACCAAGATCCACTTGCGGCAGAAGGACAAGAAAGCAGACAAAAGTGTTGTGGCCTCTTCGGCCACCTCCTCTCTCTCTTCCTACCCGTCCCCG	endogenous
ENTPD1	ectonucleoside triphosphate diphosphohydrolase 1	NM_001098175.1		CCCATATGAAACCAATAATCAGGAAACCTTTGGAGCTTTGGACCTTGGGGGAGCCTCTACACAAGTCACTTTTGTACCCCAAAACCAGACTATCGAGTCC	endogenous
ENTPD2	ectonucleoside triphosphate diphosphohydrolase 2	NM_203468.1		ACGTCCATGTTTATCTACAAGTGGCCGGCAGACAAGGAGAACGACACAGGCATTGTGGGCCAGCACAGCTCCTGTGATGTTCCAGGTGGGGGCATCTCCA	endogenous
EOMES	eomesodermin	NM_005442.2		ATCCCATGCCCTGGGGTATTACCCAGACCCAACCTTTCCTGCAATGGCAGGGTGGGGAGGTCGAGGTTCTTACCAGAGGAAGATGGCAGCTGGACTACCA	endogenous
ERAP2	endoplasmic reticulum aminopeptidase 2	NM_001130140.1		AATTCATGTATTGAAAATATTGTTCAGACCCCATGTGACATAACTGGAGCCAGTGCAGTGCCATGAAGAACTACGAGATTAGCCTGGATATTAACTTGTC	endogenous
FAM30A	family with sequence similarity 30 member A	NR_026800.2		ACAGTTCTGAAGTCAAAGGCTGATGTCCTGTTTCTCTTTCCCTCTGTGACCGACTCCCTTCCCAGTGGTAACAAGTACCCACAGCTTGGTTTGAATTTCT	endogenous
FAS	Fas cell surface death receptor	NM_000043.4		TATCGTCCAAAAGTGTTAATGCCCAAGTGACTGACATCAACTCCAAGGGATTGGAATTGAGGAAGACTGTTACTACAGTTGAGACTCAGAACTTGGAAGG	endogenous
FASLG	Fas ligand	NM_000639.1		TCCATGCCTCTGGAATGGGAAGACACCTATGGAATTGTCCTGCTTTCTGGAGTGAAGTATAAGAAGGGTGGCCTTGTGATCAATGAAACTGGGCTGTACT	endogenous
FASN	fatty acid synthase	NM_004104.4		GAGGTGCTTGGCTACGCACGGTCGCTTCCTGGAAATTGGCAAATTCGACCTTTCTCAGAACCACCCGCTCGGCATGGCTATCTTCCTGAAGAACGTGACA	endogenous
FCAR	Fc fragment of IgA receptor	NM_002000.2		TGCTGAGATTATAGGCATGAGCCACCACGCCTGGCCAGATGCATGTTCAAACCAATCAAATGGTGTTTTCTTATGCAGGACTGATCGATTTGCACCCACC	endogenous
FCGR3A/B	Fc fragment of IgG receptor IIIb	NM_000570.4		AAGGTTTGGCAGTGTCAACCATCTCATCATTCTCTCCACCTGGGTACCAAGTCTCTTTCTGCTTGGTGATGGTACTCCTTTTTGCAGTGGACACAGGACT	endogenous
FCRL2	Fc receptor like 2	NM_001159488.1		CCTCTTCTGTCTTCGAAGGAGACAGCATCGTTCTGAAATGCCAGGGAGAACAGAACTGGAAAATTCAGAAGATGGCTTACCATAAGGATAACAAAGAGTT	endogenous
FH	fumarate hydratase	NM_000143.2		GGTGAACTAAAGGTGCCAAATGATAAGTATTATGGCGCCCAGACCGTGAGATCTACGATGAACTTTAAGATTGGAGGTGTGACAGAACGCATGCCAACCC	endogenous
FKBP1A	FK506 binding protein 1A	NM_000801.4		GCTGGGCGTGAGGGGGCGTGCGCGTGCGCAGGCGACGCGCCGAGGTACTAGGCAGAGCCGTGGAACCGCCGCCAGGTCGCTGTTGGTCCACGCCGCCCGT	endogenous
FLCN	folliculin	NM_144606.5		GCTCCAGGGCAAGGCGCTCAAGGTGTTTGAGGCAGAGCAGTTTGGATGCCCACAGCGTGCTCAGAGGATGAACACAGCCTTCACGCCATTCCTACACCAG	endogenous
FNIP1	folliculin interacting protein 1	NM_001008738.2		ACAATTTGTAATCTTTACACGATGCCACGAATTGGAGAACCTGTCTGGCTTACAATGATGTCGGGGACTCCAGAAAAGAACCACCTTTGCTATCGTTTCA	endogenous
FOS	Fos proto-oncogene, AP-1 transcription factor subunit	NM_005252.2		ACTCAAGTCCTTACCTCTTCCGGAGATGTAGCAAAACGCATGGAGTGTGTATTGTTCCCAGTGACACTTCAGAGAGCTGGTAGTTAGTAGCATGTTGAGC	endogenous
FOSB	FosB proto-oncogene, AP-1 transcription factor subunit	NM_006732.1		ATATATGGATGTGTGTGTGTGCGTGCGCGTGAGTGTGTGAGCGCTTCTGCAGCCTCGGCCTAGGTCACGTTGGCCCTCAAAGCGAGCCGTTGAATTGGAA	endogenous
FOXO1	forkhead box O1	NM_002015.3		TCTCATCACCAACATCATTAACTGTTTCGACCCAGTCCTCACCTGGCACCATGATGCAGCAGACGCCGTGCTACTCGTTTGCGCCACCAAACACCAGTTT	endogenous
FOXP3	forkhead box P3	NM_014009.3		GGGCCATCCTGGAGGCTCCAGAGAAGCAGCGGACACTCAATGAGATCTACCACTGGTTCACACGCATGTTTGCCTTCTTCAGAAACCATCCTGCCACCTG	endogenous
FPR1	formyl peptide receptor 1	NM_002029.3		GCCATGGGAGGACATTGGCCTTTCGGCTGGTTCCTGTGCAAATTCGTCTTTACCATAGTGGACATCAACTTGTTCGGAAGTGTCTTCCTGATCGCCCTCA	endogenous
FYN	FYN proto-oncogene, Src family tyrosine kinase	NM_002037.3		GTCTTTGGAGGTGTGAACTCTTCGTCTCATACGGGGACCTTGCGTACGAGAGGAGGAACAGGAGTGACACTCTTTGTGGCCCTTTATGACTATGAAGCAC	endogenous
GADD45B	growth arrest and DNA damage inducible beta	NM_015675.2		TGTGGACCCAGACAGCGTGGTCCTCTGCCTCTTGGCCATTGACGAGGAGGAGGAGGATGACATCGCCCTGCAAATCCACTTCACGCTCATCCAGTCCTTC	endogenous
GARS	glycyl-tRNA synthetase	NM_002047.2		ATGCCTGGGTACTTGAGACCAGAAACTGCACAGGGGATTTTCTTGAATTTCAAACGACTTTTGGAGTTCAACCAAGGAAAGTTGCCTTTTGCTGCTGCCC	endogenous
GART	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	NM_000819.3		GCCCAACAGCAGAAGCGGCTCAGTTAGAGTCCAGCAAAAGGTTTGCCAAAGAGTTTATGGACAGACATGGAATCCCAACCGCACAATGGAAGGCTTTCAC	endogenous
GATA3	GATA binding protein 3	NM_001002295.1		GTGCATGACTCACTGGAGGACTTCCCCAAGAACAGCTCGTTTAACCCGGCCGCCCTCTCCAGACACATGTCCTCCCTGAGCCACATCTCGCCCTTCAGCC	endogenous
GFER	growth factor, augmenter of liver regeneration	NM_005262.2		TGAAACGCTGAAGTGACTGAGAACCTGGCTTCAGTATATTTTCTGCTGGGGCTTAATAAAGCAGTAGACAGGGCTTGTTCCATCCCTCTGTGCTCAGCTG	endogenous
GFM1	G elongation factor mitochondrial 1	NM_024996.5		GAAATCTATGCTCAGAGGCTGGAAAGAGAGTATGGCTGTCCTTGTATCACAGGAAAGCCAAAAGTTGCCTTTCGAGAGACCATTACTGCCCCTGTCCCGT	endogenous
GLS	glutaminase	NM_014905.3		AGTCTGGAGGAAAGGTTGCAGATTATATTCCTCAACTGGCCAAATTCAGTCCCGATTTGTGGGGTGTGTCTGTTTGTACAGTAGATGGACAGAGGCATTC	endogenous
GLS2	glutaminase 2	NM_013267.2		CCCTGGATGATGCTGTGCAGTTCAACCATCTGGAGGTGGTCAAACTGCTTCAAGATTACCAGGACTCCTACACACTCTCTGAAACTCAGGCTGAGGCAGC	endogenous
GLUD1/2	glutamate dehydrogenase 2	NM_012084.3		GCTGGAGGAGTGACAGTATCTTACTTTGAGTGGCTGAAGAATCTAAATCATGTCAGCTATGGCCGTTTGACCTTCAAATATGAAAGGGATTCTAACTACC	endogenous
GNAI2	G protein subunit alpha i2	NM_002070.2		GCCAACAAATATGATGAGGCAGCCAGCTACATCCAGAGTAAGTTTGAGGACCTGAATAAGCGCAAAGACACCAAGGAGATCTACACGCACTTCACGTGCG	endogenous
GNG10	G protein subunit gamma 10	NM_001017998.3		CTCCGGGGCTAGCGCGAGCGCCCTGCAGCGCTTGGTAGAGCAGCTCAAGTTGGAGGCTGGCGTGGAGAGGATCAAGGTCTCTCAGGCAGCTGCAGAGCTT	endogenous
GNLY	granulysin	NM_012483.3		TGTCCTCCCCTCTCACGAGAATAAAGTGTCAAGCAAGATTTTAGCCGCAGCTGCTTCTTCTTTGGTGGATTTGAGGGGTGGGTGTCAGTGGCATGCTGGG	endogenous
GOT1	glutamic-oxaloacetic transaminase 1	NM_002079.2		GTCCTCACCAACCTGGGAGAATCACAATGCTGTGTTTTCCGCTGCTGGTTTTAAAGACATTCGGTCCTATCGCTACTGGGATGCAGAGAAGAGAGGATTG	endogenous
GPI	glucose-6-phosphate isomerase	NM_000175.2		CAGTGCTCAAGTGACCTCTCACGACGCTTCTACCAATGGGCTCATCAACTTCATCAAGCAGCAGCGCGAGGCCAGAGTCCAATAAACTCGTGCTCATCTG	endogenous
GRK2	G protein-coupled receptor kinase 2	NM_001619.2		CCGAGGGGACGTGTTCCAGAAATTCATTGAGAGCGATAAGTTCACACGGTTTTGCCAGTGGAAGAATGTGGAGCTCAACATCCACCTGACCATGAATGAC	endogenous
GRK4	G protein-coupled receptor kinase 4	NM_001004057.1		CAATCCCGGCTTTGATGAGCAGAGAGCCGTTTTCTATGCTGCAGAGCTGTGTTGCGGCTTGGAAGATTTACAGAGGGAAAGAATTGTATACAGAGACTTG	endogenous
GRPEL1	GrpE like 1, mitochondrial	NM_025196.2		AGCATCATGAGTAACGTGTCTGCTCAGACTCTGCTGACACCAAAGTATTTTAAACAAATAAAAGGTCTTGGGGAATTCTGTTTGGCTACCTGGGCACGCC	endogenous
GZMA	granzyme A	NM_006144.2		AGACCCTACATGGTCCTACTTAGTCTTGACAGAAAAACCATCTGTGCTGGGGCTTTGATTGCAAAAGACTGGGTGTTGACTGCAGCTCACTGTAACTTGA	endogenous
GZMB	granzyme B	NM_004131.3		ACACTACAAGAGGTGAAGATGACAGTGCAGGAAGATCGAAAGTGCGAATCTGACTTACGCCATTATTACGACAGTACCATTGAGTTGTGCGTGGGGGACC	endogenous
GZMH	granzyme H	NM_033423.3		AAAAAAGGGACACCTCCAGGAGTCTACATCAAGGTCTCACACTTCCTGCCCTGGATAAAGAGAACAATGAAGCGCCTCTAACAGCAGGCATGAGACTAAC	endogenous
GZMK	granzyme K	NM_002104.2		CTGTAAAGGTGTCTTCCACGCTATAGTCTCTGGAGGTCATGAATGTGGTGTTGCCACAAAGCCTGGAATCTACACCCTGTTAACCAAGAAATACCAGACT	endogenous
GZMM	granzyme M	NM_005317.2		GGGCCCCTGGTGTGTGGCAAAGGCCGGGTGTTGGCCGGAGTCCTGTCCTTCAGCTCCAGGGTCTGCACTGACATCTTCAAGCCTCCCGTGGCCACCGCTG	endogenous
HACD4	3-hydroxyacyl-CoA dehydratase 4	NM_001010915.3		TGGATATGGTTAGGTACACTTATAGCATGTTATCAGTCATAGGAATATCCTATGCTGTCTTGACATGGCTCAGTCAAACACTATGGATGCCAATTTATCC	endogenous
HADHB	hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit beta	NM_000183.2		TTCTTTCTTGACTGATGGTGCATCTGCAATGTTAATCATGGCGGAGGAAAAGGCTCTGGCCATGGGTTATAAGCCGAAGGCATATTTGAGGGATTTTATG	endogenous
HAVCR2	hepatitis A virus cellular receptor 2	NM_032782.3		TATATGAAGTGGAGGAGCCCAATGAGTATTATTGCTATGTCAGCAGCAGGCAGCAACCCTCACAACCTTTGGGTTGTCGCTTTGCAATGCCATAGATCCA	endogenous
HDAC7	histone deacetylase 7	NM_001098416.2		AGGCCTGCAGCAGCAGCGCTCGGTGGAGCCCATGAGGCTCTCCATGGACACGCCGATGCCCGAGTTGCAGGTGGGACCCCAGGAACAAGAGCTGCGGCAG	endogenous
HDAC8	histone deacetylase 8	NM_018486.2		CCGGTTTATATCTATAGTCCCGAGTATGTCAGTATGTGTGACTCCCTGGCCAAGATCCCCAAACGGGCCAGTATGGTGCATTCTTTGATTGAAGCATATG	endogenous
HDC	histidine decarboxylase	NM_002112.3		GCAGGCACTGCCTTCCTGTGCCCCGAGTTCCGGGGGTTTCTGAAGGGGATTGAGTATGCCGACTCCTTCACCTTTAATCCTTCCAAGTGGATGATGGTGC	endogenous
HIF1A	hypoxia inducible factor 1 subunit alpha	NM_001530.2		ATGGATGATGACTTCCAGTTACGTTCCTTCGATCAGTTGTCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAAAGCACAGTTACAG	endogenous
HK2	hexokinase 2	NM_000189.4		TCAGAATCAGGTTGACAGTCCCTTGCTGACATGGCTTTGCTTTGTGTAAATACAGTGGATCTCAATCTTCGGGGTGTGATGAATAGCGAATCATCTCAAA	endogenous
HK3	hexokinase 3	NM_002115.1		ACTTTGCTGCCCACTGCCTGTCTGAGTTCCTGGATGCGCAGCCTGTGAACAAACAGGGTCTGCAGCTTGGCTTCAGCTTCTCTTTCCCTTGTCACCAGAC	endogenous
HLA-DQA1	major histocompatibility complex, class II, DQ alpha 1	NM_002122.3		GGTGGCCTGAGTTCAGCAAATTTGGAGGTTTTGACCCGCAGGGTGCACTGAGAAACATGGCTGTGGCAAAACACAACTTGAACATCATGATTAAACGCTA	endogenous
HLA-DRA	major histocompatibility complex, class II, DR alpha	NM_019111.3		GGCCAACATAGCTGTGGACAAAGCCAACCTGGAAATCATGACAAAGCGCTCCAACTATACTCCGATCACCAATGTACCTCCAGAGGTAACTGTGCTCACG	endogenous
HLA-DRB1	major histocompatibility complex, class II, DR beta 1	NM_002124.3		AGCACGGTCTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGGGCTTTGTGCTGGGCCTGCTCTTCCTTGGGGCCGGGCTGTTCATCTACTTCAGG	endogenous
HLA-E	major histocompatibility complex, class I, E	NM_005516.4		TGTCTTAGGGGACTCTGGCTTCTCTTTTTGCAAGGGCCTCTGAATCTGTCTGTGTCCCTGTTAGCACAATGTGAGGAGGTAGAGAAACAGTCCACCTCTG	endogenous
HMGCR	3-hydroxy-3-methylglutaryl-CoA reductase	NM_000859.2		CTTTCCAGAGCAAGCACATTAGCAAAGTTTGCCCTCAGTTCCAACTCACAGGATGAAGTAAGGGAAAATATTGCTCGTGGAATGGCAATTTTAGGTCCTA	endogenous
HSD11B1	hydroxysteroid 11-beta dehydrogenase 1	NM_005525.2		TGGAAGTCAACTTCCTCAGTTACGTGGTCCTGACTGTAGCTGCCTTGCCCATGCTGAAGCAGAGCAATGGAAGCATTGTTGTCGTCTCCTCTCTGGCTGG	endogenous
HSPA9	heat shock protein family A (Hsp70) member 9	NM_004134.4		TTCAAGAGAGAGACAGGGGTTGATTTGACTAAAGACAACATGGCACTTCAGAGGGTACGGGAAGCTGCTGAAAAGGCTAAATGTGAACTCTCCTCATCTG	endogenous
HSPE1	heat shock protein family E (Hsp10) member 1	NM_002157.2		GGGTGGAGAGATTCAACCAGTTAGCGTGAAAGTTGGAGATAAAGTTCTTCTCCCAGAATATGGAGGCACCAAAGTAGTTCTAGATGACAAGGATTATTTC	endogenous
ICAM1	intercellular adhesion molecule 1	NM_000201.2		AAATACTGAAACTTGCTGCCTATTGGGTATGCTGAGGCCCCACAGACTTACAGAAGAAGTGGCCCTCCATAGACATGTGTAGCATCAAAACACAAAGGCC	endogenous
ICOS	inducible T cell costimulator	NM_012092.2		AACTCTGGCACCCAGGCATGAAGCACGTTGGCCAGTTTTCCTCAACTTGAAGTGCAAGATTCTCTTATTTCCGGGACCACGGAGAGTCTGACTTAACTAC	endogenous
ICOSLG	inducible T cell costimulator ligand	NM_015259.5		TGAGCTCACCTTCACGTGTACATCCATAAACGGCTACCCCAGGCCCAACGTGTACTGGATCAATAAGACGGACAACAGCCTGCTGGACCAGGCTCTGCAG	endogenous
ID2	inhibitor of DNA binding 2	NM_002166.4		CGGATATCAGCATCCTGTCCTTGCAGGCTTCTGAATTCCCTTCTGAGTTAATGTCAAATGACAGCAAAGCACTGTGTGGCTGAATAAGCGGTGTTCATGA	endogenous
IDH3A	isocitrate dehydrogenase 3 (NAD(+)) alpha	NM_005530.2		TGAAAAACATAATGGAAATAAAACAGGATATTGACATAATAGCACAAAATGACACTCTTCTAAAACTAAATGGGCACAAGAGAATTTTCCTGGGAAAGTT	endogenous
IDO1	indoleamine 2,3-dioxygenase 1	NM_002164.3		CTATTATAAGATGCTCTGAAAACTCTTCAGACACTGAGGGGCACCAGAGGAGCAGACTACAAGAATGGCACACGCTATGGAAAACTCCTGGACAATCAGT	endogenous
IDO2	indoleamine 2,3-dioxygenase 2	NM_194294.2		GTTCTGCCTGGGATCATCCAGGAAGGATCTCAGCCCTATTCATGTTTCTGCTCTACAGAGCACTATATTCTCCTTGTTGAGAGCTGTTGGCTTCACAAAG	endogenous
IFI30	IFI30, lysosomal thiol reductase	NM_006332.3		CAGGAACAAAATGTCAGTGGCAGGTGGGAGTTCAAGTGCCAGCATGGAGAAGAGGAGTGCAAATTCAACAAGGTGGAGGCCTGCGTGTTGGATGAACTTG	endogenous
IFI35	interferon induced protein 35	NM_005533.3		TGCCCTCTGCTTGCGGGCTCTGCTCTGATCACCTTTGATGACCCCAAAGTGGCTGAGCAGGTGCTGCAACAAAAGGAGCACACGATCAACATGGAGGAGT	endogenous
IFI6	interferon alpha inducible protein 6	NM_002038.3		AGCAGCGTCGTCATAGGTAATATTGGTGCCCTGATGGGCTACGCCACCCACAAGTATCTCGATAGTGAGGAGGATGAGGAGTAGCCAGCAGCTCCCAGAA	endogenous
IFIT1	interferon induced protein with tetratricopeptide repeats 1	NM_001548.3		GAGAAAGGCATTAGATCTGGAAAGCTTGAGCCTCCTTGGGTTCGTCTACAAATTGGAAGGAAATATGAATGAAGCCCTGGAGTACTATGAGCGGGCCCTG	endogenous
IFIT2	interferon induced protein with tetratricopeptide repeats 2	NM_001547.4		TGCATCCCATAGAGGTTAGTCCTGCATAGCCAGTAATGTGCTAAGTTCATCCAAAAGCTGGCGGACCAAAGTCTAAATAGGGCTCAGTATCCCCCATCGC	endogenous
IFIT3	interferon induced protein with tetratricopeptide repeats 3	NM_001031683.2		CGCCTGCTAAGGGATGCCCCTTCAGGCATAGGCAGTATTTTCCTGTCAGCATCTGAGCTTGAGGATGGTAGTGAGGAAATGGGCCAGGGCGCAGTCAGCT	endogenous
IFITM3	interferon induced transmembrane protein 3	NM_021034.2		AGGGAGGGCTCACTGAGAACCATCCCAGTAACCCGACCGCCGCTGGTCTTCGCTGGACACCATGAATCACACTGTCCAAACCTTCTTCTCTCCTGTCAAC	endogenous
IFNA1	interferon alpha 1	NM_024013.1		TGACTCATACACCAGGTCACGCTTTCATGAATTCTGTCATTTCAAAGACTCTCACCCCTGCTATAACTATGACCATGCTGATAAACTGATTTATCTATTT	endogenous
IFNAR1	interferon alpha and beta receptor subunit 1	NM_000629.2		TGGTGTCTATAGTCCAGTACATTGTATAAAGACCACAGTTGAAAATGAACTACCTCCACCAGAAAATATAGAAGTCAGTGTCCAAAATCAGAACTATGTT	endogenous
IFNB1	interferon beta 1	NM_002176.2		ACAGACTTACAGGTTACCTCCGAAACTGAAGATCTCCTAGCCTGTGCCTCTGGGACTGGACAATTGCTTCAAGCATTCTTCAACCAGCAGATGCTGTTTA	endogenous
IFNG	interferon gamma	NM_000619.2		ATACTATCCAGTTACTGCCGGTTTGAAAATATGCCTGCAATCTGAGCCAGTGCTTTAATGGCATGTCAGACAGAACTTGAATGTGTCAGGTGACCCTGAT	endogenous
IFNGR1	interferon gamma receptor 1	NM_000416.2		CTCTTTGGGTCAGAGTTAAAGCCAGGGTTGGACAAAAAGAATCTGCCTATGCAAAGTCAGAAGAATTTGCTGTATGCCGAGATGGAAAAATTGGACCACC	endogenous
IFNGR2	interferon gamma receptor 2	NM_005534.3		CAGTGGCCCTGAGCAATAGCACGAGGCCTGTTGTCTACCAAGTGCAGTTTAAATACACCGACAGTAAATGGTTCACGGCCGACATCATGTCCATAGGGGT	endogenous
IGF1R	insulin like growth factor 1 receptor	NM_000875.4		TCTCCTGAGTCCCTCAAGGATGGAGTCTTCACCACTTACTCGGACGTCTGGTCCTTCGGGGTCGTCCTCTGGGAGATCGCCACACTGGCCGAGCAGCCCT	endogenous
IKBKE	inhibitor of nuclear factor kappa B kinase subunit epsilon	NM_014002.2		CCGCATCATCGAACGGCTAAATAGAGTCCCAGCACCTCCTGATGTCTGAGCTCCATGGGGCACATGAGGCATCCTGAAGCATTAGAATGATTCCAACACT	endogenous
IKZF2	IKAROS family zinc finger 2	NM_001079526.1		TGTGGGCGCTCTGTTTTTTCTTTGCAGTCCAGCCACATTAGAGGGGAGGAACCGAGTGATATTGATTCAAGTCATTTTAGGGGGACATACTTGGAAGGCA	endogenous
IKZF4	IKAROS family zinc finger 4	NM_022465.3		CTCTCCAGACCATCACTGCACTTTAACCAGGGTCTTAGGTACAAAATCCTACTTTTCAGAGCCTTCCAGCTCTGGAACCTCAAACATCCTCATGCTCTCT	endogenous
IL10	interleukin 10	NM_000572.2		AAGGATCAGCTGGACAACTTGTTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAGGGTTACCTGGGTTGCCAAGCCTTGTCTGAGATGATCCAGTTTTACC	endogenous
IL10RA	interleukin 10 receptor subunit alpha	NM_001558.2		TGCCCAGCCCTCCGTCTGTGTGGTTTGAAGCAGAATTTTTCCACCACATCCTCCACTGGACACCCATCCCAAATCAGTCTGAAAGTACCTGCTATGAAGT	endogenous
IL11	interleukin 11	NM_000641.2		TGAGACAGAGAACAGGGAATTAAATGTGTCATACATATCCACTTGAGGGCGATTTGTCTGAGAGCTGGGGCTGGATGCTTGGGTAACTGGGGCAGGGCAG	endogenous
IL12A	interleukin 12A	NM_000882.2		CTTTCTAGATCAAAACATGCTGGCAGTTATTGATGAGCTGATGCAGGCCCTGAATTTCAACAGTGAGACTGTGCCACAAAAATCCTCCCTTGAAGAACCG	endogenous
IL12B	interleukin 12B	NM_002187.2		GCAAGGCTGCAAGTACATCAGTTTTATGACAATCAGGAAGAATGCAGTGTTCTGATACCAGTGCCATCATACACTTGTGATGGATGGGAACGCAAGAGAT	endogenous
IL12RB1	interleukin 12 receptor subunit beta 1	NM_005535.1		AAGATGCCCTATCTCTCGGGTGCTGCCTACAACGTGGCTGTCATCTCCTCGAACCAATTTGGTCCTGGCCTGAACCAGACGTGGCACATTCCTGCCGACA	endogenous
IL12RB2	interleukin 12 receptor subunit beta 2	NM_001559.2		CCTCCGTGGGACATTAGAATCAAATTTCAAAAGGCTTCTGTGAGCAGATGTACCCTTTATTGGAGAGATGAGGGACTGGTACTGCTTAATCGACTCAGAT	endogenous
IL13	interleukin 13	NM_002188.2		TTTCTTTCTGATGTCAAAAATGTCTTGGGTAGGCGGGAAGGAGGGTTAGGGAGGGGTAAAATTCCTTAGCTTAGACCTCAGCCTGTGCTGCCCGTCTTCA	endogenous
IL15	interleukin 15	NM_172174.1		AGGGTGATAGTCAAATTATGTATTGGTGGGGCTGGGTACCAATGCTGCAGGTCAACAGCTATGCTGGTAGGCTCCTGCCAGTGTGGAACCACTGACTACT	endogenous
IL16	interleukin 16	NM_004513.4		GGCATCTCCAACATCATCATCCAACGAAGACTCAGCTGCAAATGGTTCTGCTGAAACATCTGCCTTGGACACAGGGTTCTCGCTCAACCTTTCAGAGCTG	endogenous
IL17A	interleukin 17A	NM_002190.2		TACTACAACCGATCCACCTCACCTTGGAATCTCCACCGCAATGAGGACCCTGAGAGATATCCCTCTGTGATCTGGGAGGCAAAGTGCCGCCACTTGGGCT	endogenous
IL17C	interleukin 17C	NM_013278.3		CTCATCTCCAGCCTCAGTAGTTGGGGGTAGAAGGAGCTCAGCACCTCTTCCAGCCCTTAAAGCTGCAGAAAAGGTGTCACACGGCTGCCTGTACCTTGGC	endogenous
IL17F	interleukin 17F	NM_052872.3		GCCCGCCTGTGCCAGGAGGTAGTATGAAGCTTGACATTGGCATCATCAATGAAAACCAGCGCGTTTCCATGTCACGTAACATCGAGAGCCGCTCCACCTC	endogenous
IL18	interleukin 18	NM_001562.2		GACAGTCAGCAAGGAATTGTCTCCCAGTGCATTTTGCCCTCCTGGCTGCCAACTCTGGCTGCTAAAGCGGCTGCCACCTGCTGCAGTCTACACAGCTTCG	endogenous
IL18BP	interleukin 18 binding protein	NM_001039659.1		CACAGCCTCCTTATAATGCCTCCTCCTCCTGCCATTCTCTCTCCACCTATCCATTAGCCTTCCTAACGTCCTACTCCTCACACTGCTCTACTGCTCAGAA	endogenous
IL19	interleukin 19	NM_013371.3		CCACAGACATGCACCATATAGAAGAGAGTTTCCAAGAAATCAAAAGAGCCATCCAAGCTAAGGACACCTTCCCAAATGTCACTATCCTGTCCACATTGGA	endogenous
IL1A	interleukin 1 alpha	NM_000575.3		ACTCCATGAAGGCTGCATGGATCAATCTGTGTCTCTGAGTATCTCTGAAACCTCTAAAACATCCAAGCTTACCTTCAAGGAGAGCATGGTGGTAGTAGCA	endogenous
IL1B	interleukin 1 beta	NM_000576.2		GGGACCAAAGGCGGCCAGGATATAACTGACTTCACCATGCAATTTGTGTCTTCCTAAAGAGAGCTGTACCCAGAGAGTCCTGTGCTGAATGTGGACTCAA	endogenous
IL1F10	interleukin 1 family member 10	NM_032556.4		GGCAGGAAGGGAGAGTCAGAGAGAGAATGGAAGATACCATGCTTCTAATTTTGAAGATGGAGTGAGGGGCCTTGAGCCAACAAATGCAGGTGTTTTTAGA	endogenous
IL1R1	interleukin 1 receptor type 1	NM_001320984.1		TCTACAGAACAAGCCTCCAGGATTCATCAACACAAAGAGAAACTTTGGTTTGTTCCTGCTAAGGTGGAGGATTCAGGACATTACTATTGCGTGGTAAGGA	endogenous
IL1RN	interleukin 1 receptor antagonist	NM_000577.3		GAGTCTGCCGCCTGCCCCGGTTGGTTCCTCTGCACAGCGATGGAAGCTGACCAGCCCGTCAGCCTCACCAATATGCCTGACGAAGGCGTCATGGTCACCA	endogenous
IL2	interleukin 2	NM_000586.2		AGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACAAACAGTGCACCTACTTCAAGTTCTACAAAGAAAACACAGCTACAACTGGAGC	endogenous
IL20	interleukin 20	NM_018724.3		GCGCCATTTGCTAAGACTCTATCTGGACAGGGTATTTAAAAACTACCAGACCCCTGACCATTATACTCTCCGGAAGATCAGCAGCCTCGCCAATTCCTTT	endogenous
IL21	interleukin 21	NM_021803.2		CATGGAGAGGATTGTCATCTGTCTGATGGTCATCTTCTTGGGGACACTGGTCCACAAATCAAGCTCCCAAGGTCAAGATCGCCACATGATTAGAATGCGT	endogenous
IL21R	interleukin 21 receptor	NM_181079.4		ACCTGGAGTGAATGGAGTGACCCGGTCATCTTTCAGACCCAGTCAGAGGAGTTAAAGGAAGGCTGGAACCCTCACCTGCTGCTTCTCCTCCTGCTTGTCA	endogenous
IL22	interleukin 22	NM_020525.4		CTATCTGATGAAGCAGGTGCTGAACTTCACCCTTGAAGAAGTGCTGTTCCCTCAATCTGATAGGTTCCAGCCTTATATGCAGGAGGTGGTGCCCTTCCTG	endogenous
IL23A	interleukin 23 subunit alpha	NM_016584.2		CAGGGACAACAGTCAGTTCTGCTTGCAAAGGATCCACCAGGGTCTGATTTTTTATGAGAAGCTGCTAGGATCGGATATTTTCACAGGGGAGCCTTCTCTG	endogenous
IL23R	interleukin 23 receptor	NM_144701.2		CATGCTTTTGGAAAATGATTCACCCAGTGAAACTATTCCAGAACAGACCCTGCTTCCTGATGAATTTGTCTCCTGTTTGGGGATCGTGAATGAGGAGTTG	endogenous
IL24	interleukin 24	NM_181339.1		CTGAACTTCAGAGCATGAAAATCACACTGTCTTCTGATATCTGCAGGGACAGAGCATTGGGGTGGGGGTAAGGTGCATCTGTTTGAAAAGTAAACGATAA	endogenous
IL25	interleukin 25	NM_022789.2		CAGCTGCTGCTTAGGGCCGCCGGAAGCTGGTGTCCTGTCATTTTCTCTCAGGAAAGGTTTTCAAAGTTCTGCCCATTTCTGGAGGCCACCACTCCTGTCT	endogenous
IL26	interleukin 26	NM_018402.1		CTGTCTCTTGCCATTGCCAAGCACAAGCAATCTTCCTTCACCAAAAGTTGTTACCCAAGGGGAACATTGTCCCAAGCTGTTGACGCTCTCTATATCAAAG	endogenous
IL27	interleukin 27	NM_145659.3		CAGGAGCTGCGGAGGGAGTTCACAGTCAGCCTGCATCTCGCCAGGAAGCTGCTCTCCGAGGTTCGGGGCCAGGCCCACCGCTTTGCGGAATCTCACCTGC	endogenous
IL2RA	interleukin 2 receptor subunit alpha	NM_000417.1		CTTGGTAAGAAGCCGGGAACAGACAACAGAAGTCATGAAGCCCAAGTGAAATCAAAGGTGCTAAATGGTCGCCCAGGAGACATCCGTTGTGCTTGCCTGC	endogenous
IL2RB	interleukin 2 receptor subunit beta	NM_000878.2		GTCCTGCTGCCCGAGCCAGGAACTGTGTGTGTTGCAGGGGGGCAGTAACTCCCCAACTCCCTCGTTAATCACAGGATCCCACGAATTTAGGCTCAGAAGC	endogenous
IL2RG	interleukin 2 receptor subunit gamma	NM_000206.1		CCACAGCTGGACTGAACAATCAGTGGATTATAGACATAAGTTCTCCTTGCCTAGTGTGGATGGGCAGAAACGCTACACGTTTCGTGTTCGGAGCCGCTTT	endogenous
IL3	interleukin 3	NM_000588.3		GCCCTTGAAGACAAGCTGGGTTAACTGCTCTAACATGATCGATGAAATTATAACACACTTAAAGCAGCCACCTTTGCCTTTGCTGGACTTCAACAACCTC	endogenous
IL31	interleukin 31	NM_001014336.1		ACACGTTGCCCGTCCGTTTACTACGACCAAGTGATGATGTACAGAAAATAGTCGAGGAATTACAGTCCCTCTCGAAGATGCTTTTGAAAGATGTGGAGGA	endogenous
IL32	interleukin 32	NM_004221.4		TTCAAAGAGGGCTACCTGGAGACAGTGGCGGCTTATTATGAGGAGCAGCACCCAGAGCTCACTCCTCTACTTGAAAAAGAAAGAGATGGATTACGGTGCC	endogenous
IL33	interleukin 33	NM_033439.2		GCCAGAAATCTTCTAACCTACCAGAGCCTAGATGAGACACCGAATTAACATTAAAATTTCAGTAACTGACTGTCCCTCATGTCCATGGCCTACCATCCCT	endogenous
IL36A	interleukin 36 alpha	NM_014440.1		CAGGATATCAATCATCGGGTGTGGGTTCTTCAGGACCAGACGCTCATAGCAGTCCCGAGGAAGGACCGTATGTCTCCAGTCACTATTGCCTTAATCTCAT	endogenous
IL36B	interleukin 36 beta	NM_014438.3		CTTGTTCTCTTCACAAAAGGCTCTGAAGACATCATGAACCCACAACGGGAGGCAGCACCCAAATCCTATGCTATTCGTGATTCTCGACAGATGGTGTGGG	endogenous
IL36G	interleukin 36 gamma	NM_019618.3		GGTGCTGAGACAGGGGCAAGGCTGCTGTTATCATCTCATTTTATAATGAAGAAGAAGCAATTACTTCATAGCAACTGAAGAACAGGATGTGGCCTCAGAA	endogenous
IL36RN	interleukin 36 receptor antagonist	NM_012275.2		GAATTCTTCCCTAGAGGCTTTAGAGGGATAACGGCTCTGCTGAAACCTTAATCTCAGACTTCCAGCCTCCTGAACGAAGAAAGAATAAATTTCGGCTGTT	endogenous
IL37	interleukin 37	NM_014439.3		AGCTCAGCCTCTGCGGAGAAAGGAAGTCCGATTCTCCTGGGGGTCTCTAAAGGGGAGTTTTGTCTCTACTGTGACAAGGATAAAGGACAAAGTCATCCAT	endogenous
IL3RA	interleukin 3 receptor subunit alpha	NM_002183.2		GACGTCCAGTACGACCTGTACTTGAACGTTGCCAACAGGCGTCAACAGTACGAGTGTCTTCACTACAAAACGGATGCTCAGGGAACACGTATCGGGTGTC	endogenous
IL4	interleukin 4	NM_000589.2		GACACTCGCTGCCTGGGTGCGACTGCACAGCAGTTCCACAGGCACAAGCAGCTGATCCGATTCCTGAAACGGCTCGACAGGAACCTCTGGGGCCTGGCGG	endogenous
IL4R	interleukin 4 receptor	NM_000418.3		AGAGGAGAATGGGGGCTTTTGCCAGCAGGACATGGGGGAGTCATGCCTTCTTCCACCTTCGGGAAGTACGAGTGCTCACATGCCCTGGGATGAGTTCCCA	endogenous
IL5	interleukin 5	NM_000879.2		CCACAGAAATTCCCACAAGTGCATTGGTGAAAGAGACCTTGGCACTGCTTTCTACTCATCGAACTCTGCTGATAGCCAATGAGACTCTGAGGATTCCTGT	endogenous
IL6	interleukin 6	NM_000600.3		GGCACTGGCAGAAAACAACCTGAACCTTCCAAAGATGGCTGAAAAAGATGGATGCTTCCAATCTGGATTCAATGAGGAGACTTGCCTGGTGAAAATCATC	endogenous
IL6R	interleukin 6 receptor	NM_000565.2		CTTTCTACATAGTGTCCATGTGCGTCGCCAGTAGTGTCGGGAGCAAGTTCAGCAAAACTCAAACCTTTCAGGGTTGTGGAATCTTGCAGCCTGATCCGCC	endogenous
IL6ST	interleukin 6 signal transducer	NM_002184.2		CAAAACACTTCGAGCACTGTCCAGTATTCTACCGTGGTACACAGTGGCTACAGACACCAAGTTCCGTCAGTCCAAGTCTTCTCAAGATCCGAGTCTACCC	endogenous
IL7	interleukin 7	NM_000880.3		AGGGTCCTGGGAGTGACTATGGGCGGTGAGAGCTTGCTCCTGCTCCAGTTGCGGTCATCATGACTACGCCCGCCTCCCGCAGACCATGTTCCATGTTTCT	endogenous
IL7R	interleukin 7 receptor	NM_002185.2		TTGCTTTGACCACTCTTCCTGAGTTCAGTGGCACTCAACATGAGTCAAGAGCATCCTGCTTCTACCATGTGGATTTGGTCACAAGGTTTAAGGTGACCCA	endogenous
IL9	interleukin 9	NM_000590.1		AAGTACTAAAGAACAACAAGTGTCCATATTTTTCCTGTGAACAGCCATGCAACCAAACCACGGCAGGCAACGCGCTGACATTTCTGAAGAGTCTTCTGGA	endogenous
IRF1	interferon regulatory factor 1	NM_002198.2		TTAGTCGAGGCAAGACGTGCGCCCGAGCCCCGCCGAACCGAGGCCACCCGGAGCCGTGCCCAGTCCACGCCGGCCGTGCCCGGCGGCCTTAAGAACCCGG	endogenous
IRF3	interferon regulatory factor 3	NM_001571.5		TCATGGCCCCAGGACCAGCCGTGGACCAAGAGGCTCGTGATGGTCAAGGTTGTGCCCACGTGCCTCAGGGCCTTGGTAGAAATGGCCCGGGTAGGGGGTG	endogenous
IRF4	interferon regulatory factor 4	NM_002460.1		GGGCACTGTTTAAAGGAAAGTTCCGAGAAGGCATCGACAAGCCGGACCCTCCCACCTGGAAGACGCGCCTGCGGTGCGCTTTGAACAAGAGCAATGACTT	endogenous
IRF5	interferon regulatory factor 5	NM_001098627.1		GCCCTGATTTCCCTGGTTTGAGACTCACTTCCTCATCTCCCTGTCCTCTGAGATAATATGAGTGAGCACTTAGGTATCATATCAGATGCTCAAGGCTGGC	endogenous
IRF6	interferon regulatory factor 6	NM_006147.2		ATCTTGGTTCAGGTCATTCCAGTAGTGGCTCGGATGATCTACGAGATGTTTTCTGGTGATTTCACACGATCCTTTGATAGTGGCAGTGTCCGCCTGCAGA	endogenous
IRF7	interferon regulatory factor 7	NM_001572.3		CGCAGCGTGAGGGTGTGTCTTCCCTGGATAGCAGCAGCCTCAGCCTCTGCCTGTCCAGCGCCAACAGCCTCTATGACGACATCGAGTGCTTCCTTATGGA	endogenous
IRF8	interferon regulatory factor 8	NM_002163.2		AGTTTAAAGAAGGGGACAAAGCTGAACCAGCCACTTGGAAGACGAGGTTACGCTGTGCTTTGAATAAGAGCCCAGATTTTGAGGAAGTGACGGACCGGTC	endogenous
IRF9	interferon regulatory factor 9	NM_006084.4		GCACTCAACAAGAGTTCTGAATTTAAGGAGGTTCCTGAGAGGGGCCGCATGGATGTTGCTGAGCCCTACAAGGTGTATCAGTTGCTGCCACCAGGAATCG	endogenous
ISG15	ISG15 ubiquitin-like modifier	NM_005101.3		CCCGGCAGCACGGTCCTGCTGGTGGTGGACAAATGCGACGAACCTCTGAGCATCCTGGTGAGGAATAACAAGGGCCGCAGCAGCACCTACGAGGTACGGC	endogenous
ITGAM	integrin subunit alpha M	NM_000632.3		GCCCTCCGAGGGTGTCCTCAAGAGGATAGTGACATTGCCTTCTTGATTGATGGCTCTGGTAGCATCATCCCACATGACTTTCGGCGGATGAAGGAGTTTG	endogenous
ITGB2	integrin subunit beta 2	NM_000211.2		CATCGACCTGTACTATCTGATGGACCTCTCCTACTCCATGCTTGATGACCTCAGGAATGTCAAGAAGCTAGGTGGCGACCTGCTCCGGGCCCTCAACGAG	endogenous
JAG1	jagged 1	NM_000214.2		TTGCTTGTGGAGGCGTGGGATTCCAGTAATGACACCGTTCAACCTGACAGTATTATTGAAAAGGCTTCTCACTCGGGCATGATCAACCCCAGCCGGCAGT	endogenous
JAK1	Janus kinase 1	NM_002227.1		GAGAACACCAAGCTCTGGTATGCTCCAAATCGCACCATCACCGTTGATGACAAGATGTCCCTCCGGCTCCACTACCGGATGAGGTTCTATTTCACCAATT	endogenous
JAK2	Janus kinase 2	NM_004972.3		TTGATGTCAGTATTAAGCAAGCAAACCAAGAGGGTTCAAATGAAAGCCGAGTTGTAACTATCCATAAGCAAGATGGTAAAAATCTGGAAATTGAACTTAG	endogenous
JUN	Jun proto-oncogene, AP-1 transcription factor subunit	NM_002228.3		ACACAGCCAGCCAGCCAGGTCGGCAGTATAGTCCGAACTGCAAATCTTATTTTCTTTTCACCTTCTCTCTAACTGCCCAGAGCTAGCGCCTGTGGCTCCC	endogenous
JUNB	JunB proto-oncogene, AP-1 transcription factor subunit	NM_002229.2		GCGCGCCTGGAGGACAAGGTGAAGACGCTCAAGGCCGAGAACGCGGGGCTGTCGAGTACCGCCGGCCTCCTCCGGGAGCAGGTGGCCCAGCTCAAACAGA	endogenous
KIR3DL1/2	killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 1	NM_013289.2		TCTCCATTTCACTTGACCCCTGCCCACCTCTCCAACCTAACTGGCTTACTTCCTAGTCTACTTGAGGCTGCAATCACACTGAGGAACTCACAATTCCAAA	endogenous
KLRB1	killer cell lectin like receptor B1	NM_002258.2		TGAGTTAAACTTACCCACAGACTCAGGCCCAGAAAGTTCTTCACCTTCATCTCTTCCTCGGGATGTCTGTCAGGGTTCACCTTGGCATCAATTTGCCCTG	endogenous
KLRC1/2	killer cell lectin like receptor C2	NM_002260.3		TATGTGAGTCAGCTTATAGGAAGTACCAAGAACAGTCAAACCCATGGAGACAGAAAGTAGAATAGTGGTTGCCAATGTCTCAGGGAGGTTGAAATAGGAG	endogenous
KLRD1	killer cell lectin like receptor D1	NM_007334.2		GTACACTAGGCCACTGGTGTACCAATTAGAAACCACTTTAGAGTTATGCCTACTGTACCCACATAATCCTAAAAATATGTTACAACTGCTACTTCATAGT	endogenous
KLRF1	killer cell lectin like receptor F1	NM_016523.2		AGTCAAAGAAAAGGAGTTCTGCCCAAACATCTCAACTTACATTTAAAGATTATTCAGTGACGTTGCACTGGTATAAAATCTTACTGGGAATATCTGGAAC	endogenous
KLRG1	killer cell lectin like receptor G1	NM_001329099.1		TCTCAAGGATTTCTTCTAATAGCTTTGTGCAGACATGCGGTGCCATCAACAAAAATGGTCTTCAAGCCTCAAGCTGTGAAGTTCCTTTACACTGGGTGTG	endogenous
KLRK1	killer cell lectin like receptor K1	NM_007360.1		GGACCAGGATTTACTTAAACTGGTGAAGTCATATCATTGGATGGGACTAGTACACATTCCAACAAATGGATCTTGGCAGTGGGAAGATGGCTCCATTCTC	endogenous
KYAT1	kynurenine aminotransferase 1	NM_004059.4		TGCTATTGGGAAACCTCTTCTCCGTGACACAGAATGTTCTGGGTGGGAGCCGCCCTTCTTCATCTTAGAGAACCAAGTGCCTCCTGTCTGAAAGGTGAGG	endogenous
LAG3	lymphocyte activating 3	NM_002286.5		CTTTTGGTGACTGGAGCCTTTGGCTTTCACCTTTGGAGAAGACAGTGGCGACCAAGACGATTTTCTGCCTTAGAGCAAGGGATTCACCCTCCGCAGGCTC	endogenous
LAIR1	leukocyte associated immunoglobulin like receptor 1	NM_002287.3		GCACCTGAGGGTAGAAAGTCACTCTAGGAAAAGCCTGAAGCAGCCATTTGGAAGGCTTCCTGTTGGATTCCTCTTCATCTAGAAAGCCAGCCAGGCAGCT	endogenous
LAMP1	lysosomal associated membrane protein 1	NM_005561.3		TAAAAAATACAGATGTGTTAGTGGCACCCAGGTCCACATGAACAACGTGACCGTAACGCTCCATGATGCCACCATCCAGGCGTACCTTTCCAACAGCAGC	endogenous
LAMP2	lysosomal associated membrane protein 2	NM_002294.2		AGACCATGGCACTGTGACATATAATGGAAGCATTTGTGGGGATGATCAGAATGGTCCCAAAATAGCAGTGCAGTTCGGACCTGGCTTTTCCTGGATTGCG	endogenous
LAMTOR1	late endosomal/lysosomal adaptor, MAPK and MTOR activator 1	NM_017907.2		CAGCCAGCAACATCATTGATGTGTCTGCTGCAGACTCACAGGGCATGGAGCAGCATGAGTACATGGACCGTGCCAGGCAGTACAGCACCCGCTTGGCTGT	endogenous
LAT	linker for activation of T cells	NM_001014987.1		TGTGTAATAGAATAAAGGCCTGCGTGTGTCTGTGTTGAGCGTGCGTCTGTGTGTGCCTGTGTGCGAGTCTGAGTCAGAGATTTGGAGATGTCTCTGTGTG	endogenous
LCK	LCK proto-oncogene, Src family tyrosine kinase	NM_005356.2		ATTAAGTGGACAGCGCCAGAAGCCATTAACTACGGGACATTCACCATCAAGTCAGATGTGTGGTCTTTTGGGATCCTGCTGACGGAAATTGTCACCCACG	endogenous
LDHA	lactate dehydrogenase A	NM_001165414.1		AACTTCCTGGCTCCTTCACTGAACATGCCTAGTCCAACATTTTTTCCCAGTGAGTCACATCCTGGGATCCAGTGTATAAATCCAATATCATGTCTTGTGC	endogenous
LDHC	lactate dehydrogenase C	NM_002301.2		TTGGATTATTGGAGAACATGGTGATTCTAGTGTGCCCTTATGGAGTGGGGTGAATGTTGCTGGTGTTGCTCTGAAGACTCTGGACCCTAAATTAGGAACG	endogenous
LEF1	lymphoid enhancer binding factor 1	NM_016269.3		CCGTCACACATCCCATCAGATGTCAACTCCAAACAAGGCATGTCCAGACATCCTCCAGCTCCTGATATCCCTACTTTTTATCCCTTGTCTCCGGGTGGTG	endogenous
LEFTY1	left-right determination factor 1	NM_020997.2		GCACTATATTCTAAGCACTTACATGTGGAGATACTGTAACCTGAGGGCAGAAAGCCCAATGTGTCATTGTTTACTTGTCCTGTCACTGGATCTGGGCTAA	endogenous
LIF	LIF, interleukin 6 family cytokine	NM_002309.3		GGGATGGAAGGCTGTCTTCTTTTGAGGATGATCAGAGAACTTGGGCATAGGAACAATCTGGCAGAAGTTTCCAGAAGGAGGTCACTTGGCATTCAGGCTC	endogenous
LILRA1	leukocyte immunoglobulin like receptor A1	NM_001278318.1		TGAAGAAGGGCCAGTTCCCCATCCCATCCATCACCTGGGAACACACAGGGCGGTATCGCTGTTTCTACGGTAGCCACACTGCAGGCTGGTCAGAGCCCAG	endogenous
LILRA5	leukocyte immunoglobulin like receptor A5	NM_181879.2		CACCCTCTCAGCCCTGCCCAGTCCTGTGGTGACCTCAGGAGAGAACGTGACCCTCCAGTGTGGCTCACGGCTGAGATTCGACAGGTTCATTCTGACTGAG	endogenous
LILRB2	leukocyte immunoglobulin like receptor B2	NM_001278405.1		GATACGACCAGAGCTTGTGAAGAACGGCCAGTTCCACATCCCATCCATCACCTGGGAACACACAGGGCGATATGGCTGTCAGTATTACAGCCGCGCTCGG	endogenous
LILRB3	leukocyte immunoglobulin like receptor B3	NM_006864.3		CGGGCCCCACAGTGGCCTCAGGAGAGAACATGACCCTGCTGTGTCAGTCACGGGGGTATTTTGACACTTTCCTTCTGACCAAAGAAGGGGCAGCCCATCC	endogenous
LILRB4	leukocyte immunoglobulin like receptor B4	NM_001278426.3		TTTCAGCCCTGCCGAGTCCTCTTGTGACCTCAGGAAAGAGCGTGACCCTGCTGTGTCAGTCACGGAGCCCAATGGACACTTTTCTTCTGATCAAGGAGCG	endogenous
LNX1	ligand of numb-protein X 1	NM_032622.2		ACAGGTGACATTTTGTTGAATGTGGATGGGGTCGAACTGACAGAGGTCAGCCGGAGTGAGGCAGTGGCATTATTGAAAAGAACATCATCCTCGATAGTAC	endogenous
LPAR6	lysophosphatidic acid receptor 6	NM_005767.3		GCACTGGCGTGTGGTTAACTGTGATCGGAGGAAGTGCACCCGCCGTTTTTGTTCAGTCTACCCACTCTCAGGGTAACAATGCCTCAGAAGCCTGCTTTGA	endogenous
LTA	lymphotoxin alpha	NM_000595.2		CTGATCAAGTCACCGGAGCTTTCAAAGAAGGAATTCTAGGCATCCCAGGGGACCACACCTCCCTGAACCATCCCTGATGTCTGTCTGGCTGAGGATTTCA	endogenous
LTB	lymphotoxin beta	NM_002341.1		AGGAACAGGCGTTTCTGACGAGCGGGACGCAGTTCTCGGACGCCGAGGGGCTGGCGCTCCCGCAGGACGGCCTCTATTACCTCTACTGTCTCGTCGGCTA	endogenous
MAF	MAF bZIP transcription factor	NM_005360.4		TAATGACTTCGATCTGATGAAGTTTGAAGTGAAAAAGGAACCGGTGGAGACCGACCGCATCATCAGCCAGTGCGGCCGTCTCATCGCCGGGGGCTCGCTG	endogenous
MAGED1	MAGE family member D1	NM_006986.3		AATGCCACCTACAATTTCTCTCAGTCTCTCAATGCCAATGACCTGGCCAACAGCAGGCCTAAGACCCCTTTCAAGGCTTGGAATGATACCACTAAGGCCC	endogenous
MAML2	mastermind like transcriptional coactivator 2	NM_032427.2		TATCAAAAGAATTCGTGTTGGGGAGAATCTCTCTGCAGGACAAGGTGGCCTCCAAATAAACAATGGACAAAGTCAGATTATGTCAGGGACCTTGCCTATG	endogenous
MAML3	mastermind like transcriptional coactivator 3	NM_018717.4		TGGAAGCCATCAACAATTTGCCCAGTAACATGCCACTGCCTTCAGCTTCTCCTCTTCACCAACTTGACCTGAAACCTTCTTTGCCCTTGCAGAACAGTGG	endogenous
MAP2K2	mitogen-activated protein kinase kinase 2	NM_030662.3		AAGCCCTCCAACATCCTCGTGAACTCTAGAGGGGAGATCAAGCTGTGTGACTTCGGGGTGAGCGGCCAGCTCATCGACTCCATGGCCAACTCCTTCGTGG	endogenous
MAP2K7	mitogen-activated protein kinase kinase 7	NM_145185.2		ACGTCATTGCCGTTAAGCAAATGCGGCGCTCCGGGAACAAGGAGGAGAACAAGCGCATCCTCATGGACCTGGATGTGGTGCTGAAGAGCCACGACTGCCC	endogenous
MAP3K14	mitogen-activated protein kinase kinase kinase 14	NM_003954.1		CCCGTGTGTGTTGGAAGGGAAAGCGTCGCAGCAAAGCCCGGAAGAAACGGAAGAAGAAGAGCTCAAAGTCCCTGGCTCATGCAGGAGTGGCCTTGGCCAA	endogenous
MAP3K7	mitogen-activated protein kinase kinase kinase 7	NM_145333.1		GCCATATTATACTGCTGCCCACGCAATGAGTTGGTGTTTACAGTGTTCCCAAGGAGTGGCTTATCTTCACAGCATGCAACCCAAAGCGCTAATTCACAGG	endogenous
MAPK12	mitogen-activated protein kinase 12	NM_002969.3		TATTCACTCCTGATGAGACCCTGGATGACTTCACGGACTTTTACCTGGTGATGCCGTTCATGGGCACCGACCTGGGCAAGCTCATGAAACATGAGAAGCT	endogenous
MAPK3	mitogen-activated protein kinase 3	NM_001040056.1		AACGTGCTCCACCGAGATCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCTTAAGATTTGTGATTTCGGCCTGGCCCGGATTGCCGATCCTG	endogenous
MAX	MYC associated factor X	NM_002382.3		AACGGGCTCATCATAATGCACTGGAACGAAAACGTAGGGACCACATCAAAGACAGCTTTCACAGTTTGCGGGACTCAGTCCCATCACTCCAAGGAGAGAA	endogenous
MCAT	malonyl-CoA-acyl carrier protein transacylase	NM_014507.3		GCAGGAGACCCTGGACCGCACCGTGCACTGTCAGCCCGCGATCTTCGTGGCATCGCTGGCCGCTGTCGAGAAACTACATCACCTGCAGCCCTCGGTGATT	endogenous
MDFIC	MyoD family inhibitor domain containing	NM_199072.4		TCGGGGCCGCTAGCCAAGAGTTCGAGGCCTTCCCGATCCGGATGTGATGAAAAAGAGCAACAGAGGGAGAAGTGTTTCAGGATTGTAGGAGTGGAAGAGG	endogenous
MDH2	malate dehydrogenase 2	NM_005918.3		CGTTGGAGTCACTTCCGCGTCACCAGCTCCTGTGCCTGCCAGTCGGTGCCCCTCCCGCTCCAGCCATGCTCTCCGCCCTCGCCCGGCCTGCCAGCGCTGC	endogenous
MFN2	mitofusin 2	NM_014874.3		CAGTGCTTCTCCCTCAACTATGACCTAAACTGTGACAAGCTGTGTGCTGACTTCCAGGAAGACATTGAGTTCCATTTCTCTCTCGGATGGACCATGCTGG	endogenous
MID1IP1	MID1 interacting protein 1	NM_021242.4		GCCACCATGATGCAAATCTGCGACACCTACAACCAGAAGCACTCGCTCTTTAACGCCATGAATCGCTTCATTGGCGCCGTGAACAACATGGACCAGACGG	endogenous
MIF	macrophage migration inhibitory factor	NM_002415.1		TCCTACAGCAAGCTGCTGTGCGGCCTGCTGGCCGAGCGCCTGCGCATCAGCCCGGACAGGGTCTACATCAACTATTACGACATGAACGCGGCCAATGTGG	endogenous
MINOS1	mitochondrial inner membrane organizing system 1	NR_033757.2		ATTTAGGTGAATGACTTTGGCATTCCATGTACCCACTAGGGGAAGCTTTATCAGGCTGCATTTGCCTTATGCAGAAGTATGCCTTTGTTCTGAGAAATGG	endogenous
MKI67	marker of proliferation Ki-67	NM_002417.2		AGCAGATGTAGAGGGAGAACTCTTAGCGTGCAGGAATCTAATGCCATCAGCAGGCAAAGCCATGCACACGCCTAAACCATCAGTAGGTGAAGAGAAAGAC	endogenous
MMP2	matrix metallopeptidase 2	NM_004530.2		CCCGGAGGGGCCTGGCAGCCGTGCCTTCAGCTCTACAGCTAATCAGCATTCTCACTCCTACCTGGTAATTTAAGATTCCAGAGAGTGGCTCCTCCCGGTG	endogenous
MMP9	matrix metallopeptidase 9	NM_004994.2		CACTACTGTGCCTTTGAGTCCGGTGGACGATGCCTGCAACGTGAACATCTTCGACGCCATCGCGGAGATTGGGAACCAGCTGTATTTGTTCAAGGATGGG	endogenous
MPC2	mitochondrial pyruvate carrier 2	NM_001143674.1		TTCTGGGCTCCAATTATGAAATGGGGGTTGGTGTGTGCTGGATTGGCTGATATGGCCAGACCTGCAGAAAAACTTAGCACAGCTCAATCTGCTGTTTTGA	endogenous
MR1	major histocompatibility complex, class I-related	NM_001531.2		AACAGTGTCATCTTACAGCTGAAGTCATAGAGGGGAAATATCCCACTCAAGATCATATAACATTCCAGGTACTCAGGATGAATGGTTTGAGGACTGGTCT	endogenous
MS4A1	membrane spanning 4-domains A1	NM_152866.2		CTTCTGATGATCCCAGCAGGGATCTATGCACCCATCTGTGTGACTGTGTGGTACCCTCTCTGGGGAGGCATTATGTATATTATTTCCGGATCACTCCTGG	endogenous
MS4A2	membrane spanning 4-domains A2	NM_000139.3		GCAAATCTTGCTCTCCCACAGGAGCCTTCCAGTGTGCCTGCATTTGAAGTCTTGGAAATATCTCCCCAGGAAGTATCTTCAGGCAGACTATTGAAGTCGG	endogenous
MS4A4A	membrane spanning 4-domains A4A	NM_024021.2		GTTTGAGGCCACCAAAAGATCAACAGACAAATGCTCCAGAAATCTATGCTGACTGTGACACAAGAGCCTCACATGAGAAATTACCAGTATCCAACTTCGA	endogenous
MT2A	metallothionein 2A	NM_005953.3		CAGGGCTGCATCTGCAAAGGGGCGTCGGACAAGTGCAGCTGCTGCGCCTGATGCTGGGACAGCCCCGCTCCCAGATGTAAAGAACGCGACTTCCACAAAC	endogenous
MTCP1	mature T cell proliferation 1	NM_001018025.3		CAAGTCACCTTCTTACCTCCCAGCTACCTCTCATGTGGCAACTCTACCCGGAGGAGCGCTACATGGATAACAACTCTCGCTTGTGGCAGATACAGCATCA	endogenous
MTHFD1	methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1	NM_005956.2		CCAGAGCAAAAAGGTGTCCCTACAGGCTTCATTCTGCCCATTCGCGACATCCGCGCCAGCGTTGGGGCTGGTTTTCTGTACCCCTTAGTAGGAACGATGA	endogenous
MTHFD1L	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like	NM_001242767.1		CACATTTGCCTCCCTCCAGATAGCAGTGAAGCCGAGATTATAGATGAAATCTTAAAGATCAATGAAGATACCAGAGTACATGGCCTTGCCCTTCAGATCT	endogenous
MTHFD2	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase	NM_006636.3		TGGAGGTGTTGGCCCCATGACAGTGGCAATGCTAATGAAGAATACCATTATTGCTGCAAAAAAGGTGCTGAGGCTTGAAGAGCGAGAAGTGCTGAAGTCT	endogenous
MTHFR	methylenetetrahydrofolate reductase	NM_005957.4		TGTCCAAGCTGGAGGTGCCACAGGAGATCAAGGACGTGATTGAGCCAATCAAAGACAACGATGCTGCCATCCGCAACTATGGCATCGAGCTGGCCGTGAG	endogenous
MTHFS	methenyltetrahydrofolate synthetase	NM_006441.2		AGGAAGTGAAGCCCTACACCCTGGCGTTGGCTTTCAAAGAACAGATTTGCCTCCAGGTCCCAGTGAATGAAAACGACATGAAGGTAGATGAAGTCCTTTA	endogenous
MTOR	mechanistic target of rapamycin kinase	NM_004958.3		TCACTCTTGCCCTCCGAACGCTTGGCAGCTTTGAATTTGAAGGCCACTCTCTGACCCAATTTGTTCGCCACTGTGCGGATCATTTCCTGAACAGTGAGCA	endogenous
MX1	MX dynamin like GTPase 1	NM_002462.2		GCCTTTAATCAGGACATCACTGCTCTCATGCAAGGAGAGGAAACTGTAGGGGAGGAAGACATTCGGCTGTTTACCAGACTCCGACACGAGTTCCACAAAT	endogenous
MYC	MYC proto-oncogene, bHLH transcription factor	NM_002467.3		TCGGACACCGAGGAGAATGTCAAGAGGCGAACACACAACGTCTTGGAGCGCCAGAGGAGGAACGAGCTAAAACGGAGCTTTTTTGCCCTGCGTGACCAGA	endogenous
MYL9	myosin light chain 9	NM_006097.3		GCCGAGCTGAGGCAGATGTTCCCACAGTGACCCCAGAGCCCTGGGCTATAGTCTCTGACCCCTCCAAGGAAAGACCACCTTCTGGGGACATGGGCTGGAG	endogenous
NAA20	N(alpha)-acetyltransferase 20, NatB catalytic subunit	NM_016100.3		AGAAGAAATCCATCATACCATTACCTCATCCTGTGAGGCCTGAAGACATTGAATAACCCTGGGCAGTGGTTCTTAGGCAGATACTCTAGATGCTTTATGG	endogenous
NBL1	NBL1, DAN family BMP antagonist	NM_182744.2		TTGCCATGGAGATCTGAAGGGGCGGGGTTAGAGCCAAGCTGCACAATTTAATATATTCAAGAGTGGGGGGAGGAAGCAGAGGTCTTCAGGGCTCTTTTTT	endogenous
NCAM1	neural cell adhesion molecule 1	NM_000615.5		GGTATTTGCCTATCCCAGTGCCACGATCTCATGGTTTCGGGATGGCCAGCTGCTGCCAAGCTCCAATTACAGCAATATCAAGATCTACAACACCCCCTCT	endogenous
NCAPD2	non-SMC condensin I complex subunit D2	NM_014865.3		CTTGCCCTTGGCAAGTTCTGCATGATCAGTGCCACTTTCTGCGACTCCCAGCTTCGTCTTCTGTTCACCATGCTGGAAAAGTCTCCACTTCCCATTGTCC	endogenous
NCAPG2	non-SMC condensin II complex subunit G2	NM_017760.5		AAAATATGTCCCATGGAGCACATTCTGGTTCGTCTGGAAACTGATTCTCGACCTGTGTCTCGGCGCCTGGTGAGCCTCATCTTTAATTCTTTCCTGCCTG	endogenous
NCAPH	non-SMC condensin I complex subunit H	NM_015341.3		TGCTACTATTCTGACCAAGTCCACTTTGGAGAACCAGAATTGGAGAGCTACCACCCTTCCTACAGATTTCAACTACAATGTTGACACTCTGGTCCAGCTT	endogenous
NCR1	natural cytotoxicity triggering receptor 1	NM_004829.5		CGATGTTTTGGCTCCTATAACAACCATGCCTGGTCTTTCCCCAGTGAGCCAGTGAAGCTCCTGGTCACAGGCGACATTGAGAACACCAGCCTTGCACCTG	endogenous
NCR2	natural cytotoxicity triggering receptor 2	NM_004828.3		ACGATGGCTTGGACCTCTCGATTCACAATCTGGGACGACCCTGATGCTGGCTTCTTCACTGTCACCATGACTGATCTGAGAGAGGAAGACTCAGGACATT	endogenous
NCR3	natural cytotoxicity triggering receptor 3	NM_147130.2		ATCCTCAGCTAGGGGCTGGTACAGTCCTCCTCCTTCGGGCTGGATTCTATGCTGTCAGCTTTCTCTCTGTGGCCGTGGGCAGCACCGTCTATTACCAGGG	endogenous
NDUFA1	NADH:ubiquinone oxidoreductase subunit A1	NM_004541.3		AAGGAAAAAAGGGTTGCTCATTTTGGGTATCACTGGAGTCTGATGGAAAGAGATAGGCGCATCTCTGGAGTTGATCGTTACTATGTGTCAAAGGGTTTGG	endogenous
NDUFA2	NADH:ubiquinone oxidoreductase subunit A2	NM_001185012.1		ATGGGCTAGGCTTTAGGGTCCGCGGTTGGTCAGACCGGAGCACTTGGCCTGAAGACCTGGAATTGGCGACTTCGATATTAACAAGGATGGCGGCGGCCGC	endogenous
NDUFA4	NDUFA4, mitochondrial complex associated	NM_002489.2		AAGTCCGTAGTGTCTCATTGCAGATAATTTTTAGCTTAGGGCCTGGTGGCTAGGTCGGTTCTCTCCTTTCCAGTCGGAGACCTCTGCCGCAAACATGCTC	endogenous
NDUFA6	NADH:ubiquinone oxidoreductase subunit A6	NM_002490.3		GAAGCAGCGGACACATGTTATGCGGTTCTTCCATGAAACAGAAGCGCCAAGGCCAAAGGATTTCCTATCCAAGTTCTATGTTGGCCACGATCCATGAAGT	endogenous
NDUFAB1	NADH:ubiquinone oxidoreductase subunit AB1	NM_005003.2		TATGAATAAAGTATCAGACCCTTTGGCTTTGCTGAGAGAGGACTCAGATGATAGTGACGAATGTCTGGCAGTGAGGACACATTTTGGCATTCTTGCTGAC	endogenous
NDUFB9	NADH:ubiquinone oxidoreductase subunit B9	NM_005005.2		CCGTAATGGCGTTCTTGGCGTCGGGACCCTACCTGACCCATCAGCAAAAGGTGTTGCGGCTTTATAAGCGGGCGCTACGCCACCTCGAGTCGTGGTGCGT	endogenous
NEDD8	neural precursor cell expressed, developmentally down-regulated 8	NM_006156.2		AGGTGGTCTTAGGCAGTGATGGACCCTCCATTTTACCTCTTTACCCTGTCGCTCATAATGAGGCATCATATATCCTCTCACTCTCTGGGACACCATAGCC	endogenous
NEK2	NIMA related kinase 2	NM_002497.3		AGAGTTTGTTCTTCGAGTGATGACTCAGTTGACTCTGGCCCTGAAGGAATGCCACAGACGAAGTGATGGTGGTCATACCGTATTGCATCGGGATCTGAAA	endogenous
NFAT5	nuclear factor of activated T cells 5	NM_173214.1		CCCTGACAACTATTCAAACCCAGGACATCTCACAGCCTGGTACTTTTCCAGCAGTTTCTGCTTCTAGTCAGCTGCCCAACAGCGATGCACTATTGCAGCA	endogenous
NFATC1	nuclear factor of activated T cells 1	NM_172389.1		CGAATTCTCTGGTGGTTGAGATCCCGCCATTTCGGAATCAGAGGATAACCAGCCCCGTTCACGTCAGTTTCTACGTCTGCAACGGGAAGAGAAAGCGAAG	endogenous
NFATC2IP	nuclear factor of activated T cells 2 interacting protein	NM_032815.3		CTAGCCCAGCAGAGGCCTTAGTCCCATTTGGGGCTTGGGAGTGACATTTGCTTGAGGCTTATACACTGGTGTGGTTGCCTGGCTTGCAGGAAATGACCAA	endogenous
NFIL3	nuclear factor, interleukin 3 regulated	NM_005384.2		GTAAGAGCTGGGCATTTAGAAAGATGTCATTTGCAATAGAGCAGTCCATTTTGTATTATGCTGAATTTTCACTGGACCTGTGATGTCATTTCACTGTGAT	endogenous
NFKB2	nuclear factor kappa B subunit 2	NM_002502.2		ATCTCCGGGGGCATCAAACCTGAAGATTTCTCGAATGGACAAGACAGCAGGCTCTGTGCGGGGTGGAGATGAAGTTTATCTGCTTTGTGACAAGGTGCAG	endogenous
NFKBIA	NFKB inhibitor alpha	NM_020529.1		GGATGAGGAGAGCTATGACACAGAGTCAGAGTTCACGGAGTTCACAGAGGACGAGCTGCCCTATGATGACTGTGTGTTTGGAGGCCAGCGTCTGACGTTA	endogenous
NKG7	natural killer cell granule protein 7	NM_005601.3		CTGTGGCGGTCCCCGTCCTGGCTATGAAACCTTGTGAGCAGAAGGCAAGAGCGGCAAGATGAGTTTTGAGCGTTGTATTCCAAAGGCCTCATCTGGAGCC	endogenous
NME1	NME/NM23 nucleoside diphosphate kinase 1	NM_000269.2		CTTGTGGTTTCACCCTGAGGAACTGGTAGATTACACGAGCTGTGCTCAGAACTGGATCTATGAATGACAGGAGGGCAGACCACATTGCTTTTCACATCCA	endogenous
NME2	NME/NM23 nucleoside diphosphate kinase 2	NM_001018137.2		TTGACTACAAGTCTTGTGCTCATGACTGGGTCTATGAATAAGAGGTGGACACAACAGCAGTCTCCTTCAGCACGGCGTGGTGTGTCCCTGGACACAGCTC	endogenous
NMT1	N-myristoyltransferase 1	NM_021079.3		TTCCTGAGCTTTTATACGCTGCCCTCCACCATCATGAACCATCCAACCCACAAGAGTCTCAAAGCTGCTTATTCTTTCTACAACGTTCACACCCAGACCC	endogenous
NOD2	nucleotide binding oligomerization domain containing 2	NM_001293557.1		TGCCTTCCTTCTACAACATGTTCAGGAATTACCAGTCCCATTGGCCCTGCCTTTGGAAGCTGCCACATGCAAGAAGTATATGGCCAAGCTGAGGACCACG	endogenous
NOTCH1	notch 1	NM_017617.3		AGGCAAAGCTGGCTCACCTTCCGCACGCGGATTAATTTGCATCTGAAATAGGAAACAAGTGAAAGCATATGGGTTAGATGTTGCCATGTGTTTTAGATGG	endogenous
NOTCH2	notch 2	NM_024408.3		AAGAGTCACCAAATTTTGAGAGTTATACTTGCTTGTGTGCTCCTGGCTGGCAAGGTCAGCGGTGTACCATTGACATTGACGAGTGTATCTCCAAGCCCTG	endogenous
NPRL3	NPR3 like, GATOR1 complex subunit	NM_001039476.2		TGCAGGTTTTCCAGCTTGCAGCTCATCTGGTGTACTGGGGCAAGGCCATCATCATCTACCCGCTGTGTGAGAACAACGTCTACATGCTGTCTCCCAATGC	endogenous
NR3C1	nuclear receptor subfamily 3 group C member 1	NM_001018077.1		GGAGATCATATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAATG	endogenous
NRF1	nuclear respiratory factor 1	NM_001040110.1		CAGCTTGCCTCCTCAGAGGTGTTGACTATCTGGGTGTTCTTGGTAACCGTTAACTCTGTCTTTCTCAGCTGCAAGCCCTGAGTCTCCAGTAGCTGAATTC	endogenous
NRL	neural retina leucine zipper	NM_006177.3		CTGTCACCCTGAGCAAATCAGTTGCTTCCTGGACTTGTGTTACTTCATCTAATTCTCATGTGGATTGGACGACTTCTGCTCCCTTTCCAGTTCTGGCATC	endogenous
NSD2	nuclear receptor binding SET domain protein 2	NM_007331.1		AAAAGAGTGCACGCCAGTATCACGTACAGTTCTTTGGTGACGCCCCAGAAAGAGCTTGGATATTTGAGAAGAGCCTCGTAGCTTTTGAAGGAGAAGGACA	endogenous
NT5E	5'-nucleotidase ecto	NM_002526.2		ATTCGGGTTTTGAAATGGATAAACTCATCGCTCAGAAAGTGAGGGGTGTGGACGTCGTGGTGGGAGGACACTCCAACACATTTCTTTACACAGGCAATCC	endogenous
OAS1	2'-5'-oligoadenylate synthetase 1	NM_001032409.1		CTCCTGACGGTCTATGCTTGGGAGCGAGGGAGCATGAAAACACATTTCAACACAGCCCAGGGATTTCGGACGGTCTTGGAATTAGTCATAAACTACCAGC	endogenous
OAS2	2'-5'-oligoadenylate synthetase 2	NM_016817.2		TGAAAAACAATTTCGAGATCCAGAAGTCCCTTGATGGGTTCACCATCCAGGTGTTCACAAAAAATCAGAGAATCTCTTTCGAGGTGCTGGCCGCCTTCAA	endogenous
OAS3	2'-5'-oligoadenylate synthetase 3	NM_006187.2		GAGTGCCTTAGACAGCCTGACTCTCCACAAACCACTGTTAAAACTTACCTGCTAGGAATGCTAGATTGAATGGGATGGGAAGAGCCTTCCCTCATTATTG	endogenous
OASL	2'-5'-oligoadenylate synthetase like	NM_198213.1		GGCGTTTCTGAGCTGTTTCCACAGCTTCCAGGAGGCAGCCAAGCATCACAAAGATGTTCTGAGGCTGATATGGAAAACCATGTGGCAAAGCCAGGACCTG	endogenous
OAT	ornithine aminotransferase	NM_000274.3		CTGGAGCGTGCTCTTCAGGATCCAAATGTGGCTGCGTTCATGGTAGAACCAATTCAGGGTGAAGCAGGCGTTGTTGTTCCGGATCCAGGTTACCTAATGG	endogenous
OMA1	OMA1 zinc metallopeptidase	NM_145243.3		TCATGGCAATCGAGTTGAGTACTTGGATAGACTTATACCTCAGGCTCTCAAAATTAGAGAGATGTGTAATTGTCCACCACTGTCTAATCCAGACCCTCGA	endogenous
OPA1	OPA1, mitochondrial dynamin like GTPase	NM_130837.1		CTGAGACCATATCCTTAAATGTAAAAGGCCCTGGACTACAGAGGATGGTGCTTGTTGACTTACCAGGTGTGATTAATACTGTGACATCAGGCATGGCTCC	endogenous
OXSM	3-oxoacyl-ACP synthase, mitochondrial	NM_017897.2		ATATCCAGATTGCATAGGCGAGTTGTCATTACAGGCATTGGCTTAGTGACTCCTCTTGGTGTTGGAACTCACCTGGTTTGGGATCGTCTTATCGGAGGAG	endogenous
PARP1	poly(ADP-ribose) polymerase 1	NM_001618.3		AAGGTTTGGGCAAAACTACCCCTGATCCTTCAGCTAACATTAGTCTGGATGGTGTAGACGTTCCTCTTGGGACCGGGATTTCATCTGGTGTGAATGACAC	endogenous
PCCA	propionyl-CoA carboxylase subunit alpha	NM_000282.3		TCTTGTTGCTAATAGAGGAGAAATTGCATGTCGGGTTATTAGAACTTGCAAGAAGATGGGCATTAAGACAGTTGCCATCCACAGTGATGTTGATGCTAGT	endogenous
PCK2	phosphoenolpyruvate carboxykinase 2, mitochondrial	NM_004563.2		GGGGAGCCAGTGAGCCAGTGGCCGTGCAACCCAGAGAAAACCCTGATTGGCCACGTGCCCGACCAGCGGGAGATCATCTCCTTCGGCAGCGGCTATGGTG	endogenous
PDCD1	programmed cell death 1	NM_005018.2		CCCTGGTGGTTGGTGTCGTGGGCGGCCTGCTGGGCAGCCTGGTGCTGCTAGTCTGGGTCCTGGCCGTCATCTGCTCCCGGGCCGCACGAGGGACAATAGG	endogenous
PDCD1LG2	programmed cell death 1 ligand 2	NM_025239.3		TGTGGAGCTGTGGCAAGTCCTCATATCAAATACAGAACATGATCTTCCTCCTGCTAATGTTGAGCCTGGAATTGCAGCTTCACCAGATAGCAGCTTTATT	endogenous
PDGFRA	platelet derived growth factor receptor alpha	NM_006206.3		TAGTGCTTGGTCGGGTCTTGGGGTCTGGAGCGTTTGGGAAGGTGGTTGAAGGAACAGCCTATGGATTAAGCCGGTCCCAACCTGTCATGAAAGTTGCAGT	endogenous
PDHA1	pyruvate dehydrogenase E1 alpha 1 subunit	NM_000284.3		TAAGAGTGACCCTATTATGCTTCTCAAGGACAGGATGGTGAACAGCAATCTTGCCAGTGTGGAAGAACTAAAGGAAATTGATGTGGAAGTGAGGAAGGAG	endogenous
PDK1	pyruvate dehydrogenase kinase 1	NM_002610.3		TGGATTGCCCATATCACGTCTTTACGCACAATACTTCCAAGGAGACCTGAAGCTGTATTCCCTAGAGGGTTACGGGACAGATGCAGTTATCTACATTAAG	endogenous
PDK3	pyruvate dehydrogenase kinase 3	NM_005391.1		TCCCACCTGTAACGTGGCGGATGTGGTGAAAGATGCATATGAAACAGCCAAGATGCTGTGTGAACAGTATTACCTGGTAGCTCCAGAGCTGGAAGTTGAA	endogenous
PDPN	podoplanin	NM_006474.4		CTCCAGGAACCAGCGAAGACCGCTATAAGTCTGGCTTGACAACTCTGGTGGCAACAAGTGTCAACAGTGTAACAGGCATTCGCATCGAGGATCTGCCAAC	endogenous
PECAM1	platelet and endothelial cell adhesion molecule 1	NM_000442.3		ATCTGCACTGCAGGTATTGACAAAGTGGTCAAGAAAAGCAACACAGTCCAGATAGTCGTATGTGAAATGCTCTCCCAGCCCAGGATTTCTTATGATGCCC	endogenous
PFKFB4	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4	NM_004567.2		TGATGCCACAAACACCACCCGAGAACGGAGAGCGACCATCTTTAATTTTGGAGAACAGAATGGCTACAAGACCTTTTTTGTCGAGTCCATCTGTGTGGAT	endogenous
PFKL	phosphofructokinase, liver type	NM_001002021.1		TGCGGAACGAGAAGTGCCATGACTACTACACCACGGAGTTCCTGTACAACCTGTACTCATCAGAGGGCAAGGGCGTCTTCGACTGCAGGACCAATGTCCT	endogenous
PFKP	phosphofructokinase, platelet	NM_002627.3		GTCAAACTCTCGGAGAACCGTGCCCGGAAAAAAAGGCTGAATATTATTATTGTGGCTGAAGGAGCAATTGATACCCAAAATAAACCCATCACCTCTGAGA	endogenous
PGAM1	phosphoglycerate mutase 1	NM_002629.2		ATGGAAAAGCTCCCCTTATCCAACAGAGTTTAAAAGTAGTGACTTGGGTTTTTGCGAGTGCTTTGTTTACTAAGGACTTTGGGGAGGAACCATGCTAAGC	endogenous
PGK1	phosphoglycerate kinase 1	NM_000291.2		GCAAGAAGTATGCTGAGGCTGTCACTCGGGCTAAGCAGATTGTGTGGAATGGTCCTGTGGGGGTATTTGAATGGGAAGCTTTTGCCCGGGGAACCAAAGC	endogenous
PHGDH	phosphoglycerate dehydrogenase	NM_006623.2		GCGACGGCTTCGATGAAGGACGGCAAATGGGAGCGGAAGAAGTTCATGGGAACAGAGCTGAATGGAAAGACCCTGGGAATTCTTGGCCTGGGCAGGATTG	endogenous
PIDD1	p53-induced death domain protein 1	NM_145886.2		GGGCGAAGAGTTCTTTGCGGCCTTCGAGCGCGGCATCGACGTGGATGCTGACCGCCCTGACTGTGTGGAGGGCAGAATCTGCTTTGTCTTCTACTCGCAC	endogenous
PIK3C3	phosphatidylinositol 3-kinase catalytic subunit type 3	NM_002647.2		GGACTCCTTGGAGCTGTTATCCTCTCATTACACCAACCCAACTGTGAGGCGTTATGCTGTTGCCCGGTTGCGACAGGCCGATGATGAGGATTTGTTGATG	endogenous
PIK3R1	phosphoinositide-3-kinase regulatory subunit 1	NM_181504.2		TCATGATGAGAAGACATGGAATGTTGGAAGCAGCAACCGAAACAAAGCTGAAAACCTGTTGCGAGGGAAGCGAGATGGCACTTTTCTTGTCCGGGAGAGC	endogenous
PIK3R2	phosphoinositide-3-kinase regulatory subunit 2	NM_005027.2		CCAGCCTGGGCACCCTGATTTTTAAGCCATAGACCTGGGGTCAGGGCAGGAAGGAACTTCACTCTGCTGCTTCCGAGAACCTCGGCCGTGACATTCGGGG	endogenous
PIK3R3	phosphoinositide-3-kinase regulatory subunit 3	NM_003629.3		TGATGGGACCTCCACTTATTTAGGCCTCATGTGCTTTGAAGAAGCTTTGAGAGCCAATGTGTCTTCCACGGGTCTCTTTTTTGCTACAAGTAATCAGCCC	endogenous
PKM	pyruvate kinase M1/2	NM_182471.1		ATGGCAAGAGGGTGACAGCTTCCTTTCCTGTGTGTACTCTGTCCAGTTCCTTTAGAAAAAATGGATGCCCAGAGGACTCCCAACCCTGGCTTGGGGTCAA	endogenous
PLA2G4B	phospholipase A2 group IVB	NM_001114633.1		GCCACTGCCCCATCATTCCTGCTCCTGAGGACTCAGTCTCATGGCTGTGGCAGAGGTGTCCAGGACCTGCCTGCTCACGGTTCGTGTCCTGCAGGCCCAT	endogenous
PLCB2	phospholipase C beta 2	NM_004573.2		TCCTCCGTGTGGATCCTAAGGGCTACTACTTATACTGGACGTATCAAAGTAAGGAGATGGAGTTTCTGGATATCACCAGCATCCGGGATACTCGCTTTGG	endogenous
PLCB3	phospholipase C beta 3	NM_000932.2		GAAGCTGATGACGGTGGTGTCTGGGCCAGACCCAGTGAACACAGTGTTCTTGAACTTCATGGCCGTGCAGGATGACACAGCCAAGGTCTGGTCTGAGGAG	endogenous
PLCG1	phospholipase C gamma 1	NM_002660.2		GTGATGCTAGGGAACTCGGAGTTCGACAGCCTTGTTGACCTCATCAGCTACTATGAGAAACACCCGCTATACCGCAAGATGAAGCTGCGCTATCCCATCA	endogenous
PML	promyelocytic leukemia	NM_002675.3		TCGGAGGAGGAGTTCCAGTTTCTGCGCTGCCAGCAATGCCAGGCGGAAGCCAAGTGCCCGAAGCTGCTGCCTTGTCTGCACACGCTGTGCTCAGGATGCC	endogenous
PNOC	prepronociceptin	NM_001284244.1		CGGGGCCCGGAAGTCGGCCAGGAAGTTGGCCAATCAGAAGCGGTTCAGTGAGTTTATGAGGCAATACTTGGTCCTGAGCATGCAGTCCAGCCAGCGCCGG	endogenous
PPARA	peroxisome proliferator activated receptor alpha	NM_001001928.2		CAAGAAATGGGAAACATCCAAGAGATTTCGCAATCCATCGGCGAGGATAGTTCTGGAAGCTTTGGCTTTACGGAATACCAGTATTTAGGAAGCTGTCCTG	endogenous
PPARD	peroxisome proliferator activated receptor delta	NM_006238.4		AGGCCCGCAGCATCCTCACCGGCAAAGCCAGCCACACGGCGCCCTTTGTGATCCACGACATCGAGACATTGTGGCAGGCAGAGAAGGGGCTGGTGTGGAA	endogenous
PPARGC1A	PPARG coactivator 1 alpha	NM_013261.3		GAACAAGCACTTCGGTCATCCCAGTCAAGCTGTTTTTGACGACGAAGCAGACAAGACCGGTGAACTGAGGGACAGTGATTTCAGTAATGAACAATTCTCC	endogenous
PPAT	phosphoribosyl pyrophosphate amidotransferase	NM_002703.3		GGAAAGTGTGGACTTCCATATGTGGAGGTGCTGTGTAAAAACCGGTATGTAGGGAGAACCTTCATTCAGCCAAACATGAGGTTAAGACAACTTGGTGTTG	endogenous
PPIA	peptidylprolyl isomerase A	NM_021130.3		TCTATGGGGAGAAATTTGAAGATGAGAACTTCATCCTAAAGCATACGGGTCCTGGCATCTTGTCCATGGCAAATGCTGGACCCAACACAAATGGTTCCCA	endogenous
PPP2R5D	protein phosphatase 2 regulatory subunit B'delta	NM_006245.2		CTATGGCAAGTTTTTGGGGCTCCGGGCTTATATCCGTAGGCAGATCAACCACATCTTCTACAGGTTCATCTACGAGACGGAGCATCACAACGGGATTGCT	endogenous
PPP3CA	protein phosphatase 3 catalytic subunit alpha	NM_000944.4		GGTGCCTACTTCCACTGTAAGAAAGAATCTTGGTGGATTTGTGTCTCAAATCAGATAAGAGAAGCCTGTTTAAAGAGCAGATGCCATCTTCTGGCTTCCT	endogenous
PPT2	palmitoyl-protein thioesterase 2	NM_001204103.1		CCTACCTCATGTCCTCTCATTTGGGGGATTGCTCCGTGCTGTCCCTTTCTCTCAAGGCCGAAGTTGGGAAGTGAGAAACCATGTTTTTAACTTGTGGCTG	endogenous
PRDM1	PR/SET domain 1	NM_182907.1		CATCCCTGCCAACCAGGAACTTCTTGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGAATCTCACA	endogenous
PRF1	perforin 1	NM_005041.3		ACTGTTTTTCAGGGAGGTGGCTGGGTTTACACGCTAATCCCGATTCACCCTGTCCAAACTGCCTAAGCCCTCCGCCATTCTCAAGCCCTGCAGTCACAGC	endogenous
PRICKLE3	prickle planar cell polarity protein 3	NM_006150.3		CGCCACTATCAATGTGACGCGGGATCAGGGTCAGACTCGGAATCTTGCTCCAGCTCGCCCTCCAGTTCCAGTTCCGAATCATCAGAGGATGATGGCTTCT	endogenous
PRKAB2	protein kinase AMP-activated non-catalytic subunit beta 2	NM_005399.3		AAGTGACTTTGAAAAGTTTTGTGGCACCTGACCCACCCCAGACACTAGGGCTATCAGAAGGTCTCCTTTTTAGCCCAGCACAGGCCCAGGCCACTTTGTC	endogenous
PRKCB	protein kinase C beta	NM_212535.1		GCATTTGGAGTCCTGCTGTATGAAATGTTGGCTGGGCAGGCACCCTTTGAAGGGGAGGATGAAGATGAACTCTTCCAATCCATCATGGAACACAACGTAG	endogenous
PRKCD	protein kinase C delta	NM_006254.3		ACCATAAACTGGACTCTGCTGGAAAAGCGGAGGTTGGAGCCACCTTTCAGGCCCAAAGTGAAGTCACCCAGAGACTACAGTAACTTTGACCAGGAGTTCC	endogenous
PROCR	protein C receptor	NM_006404.3		TCCGGAGCCTCAACTTCAGGATGTTGACAACATTGCTGCCGATACTGCTGCTGTCTGGCTGGGCCTTTTGTAGCCAAGACGCCTCAGATGGCCTCCAAAG	endogenous
PSAT1	phosphoserine aminotransferase 1	NM_021154.3		TGGGGTCTCCTGGGTTCAGCGGCTGTTGATTCAAGGTCAACATTGACCATTGGAGGAGTGGTTTAAGAGTGCCAGGCGAAGGGCAAACTGTAGATCGATC	endogenous
PSMA2	proteasome subunit alpha 2	NM_002787.4		GTTGGAATGAGGGACGACCATATTTATTTCAGTCAGATCCATCTGGAGCTTACTTTGCCTGGAAAGCTACAGCAATGGGAAAGAACTATGTGAATGGGAA	endogenous
PSMA3	proteasome subunit alpha 3	NM_152132.1		GCAACTCTACATGATTGACCCATCAGGTGTTTCATACGGTTATTGGGGCTGTGCCATCGGCAAAGCCAGGCAAGCTGCAAAGACGGAAATAGAGAAGCTT	endogenous
PSMA6	proteasome subunit alpha 6	NM_002791.1		TAACAACAAACCAACATCATGGAGGTCCCTGGATTGAAAAAGGAGCCTCTCCCACTCCTCCTACCACCGAAGTGGTTAGGACTCTATATAAATAAAAACA	endogenous
PSMB10	proteasome subunit beta 10	NM_002801.2		ACCATCGCGGGCCTGGTGTTCCAAGACGGGGTCATTCTGGGCGCCGATACGCGAGCCACTAACGATTCGGTCGTGGCGGACAAGAGCTGCGAGAAGATCC	endogenous
PSPH	phosphoserine phosphatase	NM_004577.3		GCTGTGAGGCCTAGCGAAGATGAAGATAGAATGCAAGGTAGAAAGTGCTGGATACCTTTAGAAAGCTGCAGGACTGGTGCGATGGGAGTTGAGACGTAAG	endogenous
PTCD1	pentatricopeptide repeat domain 1	NM_015545.2		GACCTGCCACCATGCCATATAGGGACACACCTCAGAAACCCTTCCTTGACAGCTCTGGACAGGGAAAATTTGGCTCCCTCATGAAGGTAGAACCAGCTGC	endogenous
PTGDR2	prostaglandin D2 receptor 2	NM_004778.1		GCCAATGCTTACTGCGCTAGACGCTTCATCCCACAATCTTAAGGGGCAGCTTCTATTAGCCAGTCTTTACAGCTGAGCACATTCTGGCTCAGGGAGGTTA	endogenous
PTGER2	prostaglandin E receptor 2	NM_000956.2		GTCAGAAGGAGCTACAAAACCTACCCTCAGTGAGCATGGTACTTGGCCTTTGGAGGAACAATCGGCTGCATTGAAGATCCAGCTGCCTATTGATTTAAGC	endogenous
PTGER4	prostaglandin E receptor 4	NM_000958.2		CACTACGTGGACAAGCGATTGGCGGGCCTCACGCTCTTTGCAGTCTATGCGTCCAACGTGCTCTTTTGCGCGCTGCCCAACATGGGTCTCGGTAGCTCGC	endogenous
PTGS1	prostaglandin-endoperoxide synthase 1	NM_000962.2		ACCCCCAAGGCACCAACCTCATGTTTGCCTTCTTTGCACAACACTTCACCCACCAGTTCTTCAAAACTTCTGGCAAGATGGGTCCTGGCTTCACCAAGGC	endogenous
PTGS2	prostaglandin-endoperoxide synthase 2	NM_000963.1		GCTACAAAAGCTGGGAAGCCTTCTCTAACCTCTCCTATTATACTAGAGCCCTTCCTCCTGTGCCTGATGATTGCCCGACTCCCTTGGGTGTCAAAGGTAA	endogenous
PTK2B	protein tyrosine kinase 2 beta	NM_004103.3		CCAGTAGATGTGGAAAAGGAGGACGTGCGTATCCTCAAGGTCTGCTTCTATAGCAACAGCTTCAATCCTGGGAAAAACTTCAAACTGGTCAAATGCACTG	endogenous
PTPN6	protein tyrosine phosphatase, non-receptor type 6	NM_002831.5		TGGTGCAGACGGAGGCGCAGTACAAGTTCATCTACGTGGCCATCGCCCAGTTCATTGAAACCACTAAGAAGAAGCTGGAGGTCCTGCAGTCGCAGAAGGG	endogenous
PTPRC	protein tyrosine phosphatase, receptor type C	NM_080921.2		AGGAGGAAATTGTTCCTCGTCTGATAAGACAACAGTGGAGAAAGGACGCATGCTGTTTCTTAGGGACACGGCTGACTTCCAGATATGACCATGTATTTGT	endogenous
PYCR1	pyrroline-5-carboxylate reductase 1	NM_006907.2		TGGATGAAATAGGCGCCGACATTGAGGACAGACACATTGTGGTGTCCTGCGCGGCCGGCGTCACCATCAGCTCCATTGAGAAGAAGCTGTCAGCGTTTCG	endogenous
PYCR2	pyrroline-5-carboxylate reductase 2	NM_013328.2		AGGTCCTTGTGATAAAACCTCCTTAAATCTGTTCAGACCAAGCAATGCGAGCTTCCTCTCCTGTCCCATGTTGGAAGTTGCTCTGAAGGGGTGGTAGATG	endogenous
PYCR3	pyrroline-5-carboxylate reductase 3	NM_023078.2		CTGAGGGGCCCAAGAGATGGCGTCTTGGTCATTTGCCCGCATGGTTGGGCAGTTGGTTGAGGCCATGAACAGAACTTACGGTAACAGGCACGGCTGGCCC	endogenous
RAC2	Rac family small GTPase 2	NM_002872.4		ACGACCGTCTCCGGCCGCTCTCCTATCCACAGACGGACGTCTTCCTCATCTGCTTCTCCCTCGTCAGCCCAGCCTCTTATGAGAACGTCCGCGCCAAGTG	endogenous
RAE1	ribonucleic acid export 1	NM_003610.3		CAGCATCGGTGTGTGGCTATTTTTAAAGACAAACAGAACAAGCCTACTGGTTTTGCCCTGGGAAGTATCGAGGGGAGAGTTGCTATTCACTATATCAACC	endogenous
RAG2	recombination activating 2	NM_000536.3		AGTATGGGTGTTCTCTTTGGAGGACGCTCATACATGCCTTCTACCCACAGAACCACAGAAAAATGGAATAGTGTAGCTGACTGCCTGCCCTGTGTTTTCC	endogenous
RAI1	retinoic acid induced 1	NM_030665.3		GGGCTGATCCGTTATGCAGAAATCCAACCAACAGATCCTTAAAAGGCAAACTCATGAACAGTAAGAAACTGTCTTCTACTGACTGTTTCAAAACCGAGGC	endogenous
RARB	retinoic acid receptor beta	NM_000965.3		TAACAACTCCCAAAGAAACAGGCATAGAATCTGCCTCCTTTGACCTTGTTCAATCACTATGAAGCAGAGTGAAAGCTGTGGTAGAGTGGTTAACAGATAC	endogenous
RARG	retinoic acid receptor gamma	NM_000966.3		GCCAGCCCTACATGTTCCCAAGGATGCTAATGAAAATCACCGACCTCCGGGGCATCAGCACTAAGGGAGCTGAAAGGGCCATTACTCTGAAGATGGAGAT	endogenous
RBX1	ring-box 1	NM_014248.2		ATTATGGATCTTTGCATAGAATGTCAAGCTAACCAGGCGTCCGCTACTTCAGAAGAGTGTACTGTCGCATGGGGAGTCTGTAACCATGCTTTTCACTTCC	endogenous
RDH10	retinol dehydrogenase 10	NM_172037.2		CCACTGTAACTTGCAGGTTTTTACCTACACCTGTGACGTGGGGAAGAGGGAGAACGTCTACCTGACGGCTGAAAGAGTCCGCAAGGAGGTTGGCGAAGTC	endogenous
RDH14	retinol dehydrogenase 14	NM_020905.3		TGGGTTTGAGATGCAGTTCGGAGTGAACCATCTGGGGCACTTTCTACTCACCAATCTTCTCCTTGGACTCCTCAAAAGTTCAGCTCCCAGCAGGATTGTG	endogenous
RDH5	retinol dehydrogenase 5	NM_002905.3		TGGTTGCTCAGGGACCGGCAGAGCCTGCCCGCCAGCAATGCCTTTGTCTTCATCACCGGCTGTGACTCAGGCTTTGGGCGCCTTCTGGCACTGCAGCTGG	endogenous
RELA	RELA proto-oncogene, NF-kB subunit	NM_021975.3		GAAGCATTAACTTCTCTGGAAAGGGGGGAGCTGGGGAAACTCAAACTTTTCCCCTGTCCTGATGGTCAGCTCCCTTCTCTGTAGGGAACTCTGGGGTCCC	endogenous
RIMKLA	ribosomal modification protein rimK like family member A	NM_173642.3		CCCTTGAAACTCTACTTTTATCTAAGATCCAGACACCTGTCCTTACCCACTTTTCCAAACGGGGAAGACTCAGGTATCAGGAATTACCCATTGCACATTT	endogenous
RNASEL	ribonuclease L	NM_021133.3		GCTGTTGAACTCAAACTGAAGAAAATCGCCGAGTTGCTGTGCAAACGTGGAGCCAGTACAGATTGTGGGGATCTTGTTATGACAGCGAGGCGGAATTATG	endogenous
RORA	RAR related orphan receptor A	NM_134261.2		AAAATTAACCGAGACACTTTATATGGCCCTGCACAGACCTGGAGCGCCACACACTGCACATCTTTTGGTGATCGGGGTCAGGCAAAGGAGGGGAAACAAT	endogenous
RORC	RAR related orphan receptor C	NM_001001523.1		CTCATCAATGCCCATCGGCCAGGGCTCCAAGAGAAAAGGAAAGTAGAACAGCTGCAGTACAATCTGGAGCTGGCCTTTCATCATCATCTCTGCAAGACTC	endogenous
RPL23	ribosomal protein L23	NM_000978.3		CTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTGGTGCGAAATTCCGGATTTCCTTGGGTCTTCCGGTAGGAGCTGTAATCAAT	endogenous
RPL3	ribosomal protein L3	NM_001033853.1		TGGGAAGGTGAAGAGCTTCCCTAAGGATGACCCGTCCAAGCCGGTCCACCTCACAGCCTTCCTGGGATACAAGGCTGGCATGACTCACATCGTGCGGGAA	endogenous
RPTOR	regulatory associated protein of MTOR complex 1	NM_020761.2		GGCTGTCTTCACAGGTCTGATGTGAAAATTCAATCACGACGTTAACCGGCTCGAGAGAGCGCCGGCCTAGAGGCTCATTATCTATTTATTTTACCAAACG	endogenous
RUNX3	runt related transcription factor 3	NM_004350.1		GTGGTCTCATAATTCCATTTGTGGAGAGAACAGGAGGGCCAGATAGATAGGTCCTAGCAGAAGGCATTGAGGTGAGGGATCATTTTGGGTCAGACATCAA	endogenous
S100A12	S100 calcium binding protein A12	NM_005621.1		CAAGATGAACAGGTCGACTTTCAAGAATTCATATCCCTGGTAGCCATTGCGCTGAAGGCTGCCCATTACCACACCCACAAAGAGTAGGTAGCTCTCTGAA	endogenous
SCD	stearoyl-CoA desaturase	NM_005063.4		GTTGATTATCTTCAGCCCAGGCTTTTGCTAGATGGAATGGAAAAGCAACTTCATTTGACACAAAGCTTCTAAAGCAGGTAAATTGTCGGGGGAGAGAGTT	endogenous
SDHB	succinate dehydrogenase complex iron sulfur subunit B	NM_003000.2		CTGCAGCCACAGCTCCCCGTATCAAGAAATTTGCCATCTATCGATGGGACCCAGACAAGGCTGGAGACAAACCTCATATGCAGACTTATGAAGTTGACCT	endogenous
SEC22B	SEC22 homolog B, vesicle trafficking protein (gene/pseudogene)	NM_004892.5		GAGGACGGCGCCAAGGGCCTTCCGGGCCAGTGTTGGATCCCTGTAGTTTGTGAAGATGGTGTTGCTAACAATGATCGCCCGAGTGGCGGACGGGCTCCCG	endogenous
SELL	selectin L	NR_029467.1		CTAACTCCAGTGAAGTAATGGGGTCCTGCTCAAGTTGAAAGAGTCCTATTTGCACTGTAGCCTCGCCGTCTGTGAATTGGACCATCCTATTTAACTGGCT	endogenous
SELPLG	selectin P ligand	NM_003006.3		CATGGGCTGTTAGGTTGACTTCAGTTTTGCCTCTTGGACAACAGGGGGTCTTGTACATCCTTGGGTGACCAGGAAAAGTTCAGGCTATGGGGGGCCAAAG	endogenous
SERINC1	serine incorporator 1	NM_020755.2		CCATGGCGAGCTGGATACCATGTTTGTGTGGAAGTGCCCCGTGTTTGCTATGCCGATGCTGTCCTAGTGGAAACAACTCCACTGTAACTAGATTGATCTA	endogenous
SERINC3	serine incorporator 3	NM_006811.2		TGCAGCGGTGCCTCATGTTTGCTGTGTAGTTGCTGTCCTAACAGTAAGAATTCCACGGTGACTCGCCTCATTTATGCTTTCATTCTCCTCCTGAGCACTG	endogenous
SERINC4	serine incorporator 4	NM_001258031.1		TTCTGGCTCCTCAAGCTGCTGTTCCTGTTAGGTCTCTGTGCTATTGCCTTCTGCATTCCTGATGAGCATCTCTTCCCAGCATGGCATTACATTGGCATCT	endogenous
SERPINB9	serpin family B member 9	NM_004155.3		GTTGATGCCTTCCAACAGGGCAAGGCTGACTTGTCGGCAATGTCAGCGGAGAGAGACCTGTGTCTGTCCAAGTTCGTGCACAAGAGTTTTGTGGAGGTGA	endogenous
SGK3	serum/glucocorticoid regulated kinase family member 3	NM_013257.3		CAAATGGACAGTCCAAAACACCAGTCAGATCCATCTGAAGATGAGGATGAAAGAAGTTCTCAGAAGCTACACTCTACCTCACAGAACATCAACCTGGGAC	endogenous
SGO2	shugoshin 2	NM_152524.5		AGACCTCCATAGATCCTTCTCCAGAGAGCCATGAAGTAATGGAAAGAATACTTGACAGCGTTCAGGGAAAGTCTACTGTATCTGAACAAGCTGATAAGGA	endogenous
SH2D1A	SH2 domain containing 1A	NM_002351.4		GCTGTATCACGGTTACATTTATACATACCGAGTGTCCCAGACAGAAACAGGTTCTTGGAGTGCTGAGACAGCACCTGGGGTACATAAAAGATATTTCCGG	endogenous
SH3BP2	SH3 domain binding protein 2	NM_003023.4		GCCATGAGGAGTTCCCATGACCTCCCGAGACTTGCCATAAGTGTTCTAGTCCACATATAAGGGTAGGGTTGGGATTACCATTTACTGACCACATCTGTGA	endogenous
SHMT1	serine hydroxymethyltransferase 1	NM_148918.1		TCGCCACTTGGTCATAATCATTTAGATGGTGGTGTAGGGCAAAGCTGTTAGAAAGATTGTAGCGTTTTACTCTCCCTGGGCTTTCCTCCGCCTTGCTGCA	endogenous
SHMT2	serine hydroxymethyltransferase 2	NM_001166356.1		CCAGCCTTAACTTCTCGACAGTTCCGTGAGGATGACTTCCGGAGAGTTGTGGACTTTATAGATGAAGGGGTCAACATTGGCTTAGAGGTGAAGAGCAAGA	endogenous
SIGLEC5	sialic acid binding Ig like lectin 5	NM_003830.3		GTCCTGCTGCTGCAAGGGAGATCGAACCTCGGGACAGGAGTGGTTCCTGCAGCCCTTGGTGGTGCTGGTGTCATGGCCCTGCTCTGTATCTGTCTGTGCC	endogenous
SIK1	salt inducible kinase 1	NM_173354.2		GCTTCTTCCTGCTGCACCTCCCGTTTCCGCTGCTGCTGACGTTTATGCATTTCATGATGGGGTCCAACAAGAACACCTGACTTGGGTGAAGTTGTGCAAT	endogenous
SKP1	S-phase kinase associated protein 1	NM_170679.2		CCCAGGTACGCAAAGAGAACCAGTGGTGTGAAGAGAAGTGAAATGTTGTGCCTGACACTGTAACACTGTAAGGATTGTTCCAAATACTAGTTGCACTGCT	endogenous
SLAMF6	SLAM family member 6	NM_001184714.1		TCCAACGAACAACACTGTGTATGCTTCAGTCACTCATTCAAACAGGGAAACAGAAATCTGGACACCTAGAGAAAATGATACTATCACAATTTACTCCACA	endogenous
SLAMF7	SLAM family member 7	NM_021181.4		CAATCCTAAAGGAAGATCCAGCAAATACGGTTTACTCCACTGTGGAAATACCGAAAAAGATGGAAAATCCCCACTCACTGCTCACGATGCCAGACACACC	endogenous
SLC25A20	solute carrier family 25 member 20	NM_000387.5		GTTCTCACTGGAGGCACTGTGCATATTTTCAACCAGATCACCAGGAGCTGAGATCTTCTTCAGTCCCTAGCCAGGAATACCCATTTGATTTCCAGGGTGC	endogenous
SLC25A6	solute carrier family 25 member 6	NM_001636.3		AGAACCACGTAGAATCCTCAACCGTGCGGACCATCAACCTTCGAGAAATTCCAGTTGTCTTTTTCCCAGCCGCATCCTGCCTGTAGATGGCCGGGGAAGG	endogenous
SLC27A3	solute carrier family 27 member 3	NM_024330.1		TGCTAAAGGATGTCTTCCGGCCTGGGGATGTTTTCTTCAACACTGGGGACCTGCTGGTCTGCGATGACCAAGGTTTTCTCCGCTTCCATGATCGTACTGG	endogenous
SLC2A1	solute carrier family 2 member 1	NM_006516.2		AGGCTCCATTAGGATTTGCCCCTTCCCATCTCTTCCTACCCAACCACTCAAATTAATCTTTCTTTACCTGAGACCAGTTGGGAGCACTGGAGTGCAGGGA	endogenous
SLC2A11	solute carrier family 2 member 11	NM_030807.4		GACCTTGCACATTCAGGAATTCACCAATGAGACATGGCAGGCGCGTACTGGAGAGCCACTGCCCGATCACCTAGTCCTGCTTATGTGGTCCCTCATCGTG	endogenous
SLC2A2	solute carrier family 2 member 2	NM_000340.1		CAATTATGGAAATATAGTTCTGATGGGTCCCAAAAGCTTAGCAGGGTGCTAACGTATCTCTAGGCTGTTTTCTCCACCAACTGGAGCACTGATCAATCCT	endogenous
SLC3A2	solute carrier family 3 member 2	NM_001012662.2		AAAATCCCTAGTCACACAGTATTTGAATGCCACTGGCAATCGCTGGTGCAGCTGGAGTTTGTCTCAGGCAAGGCTCCTGACTTCCTTCTTGCCGGCTCAA	endogenous
SLC7A5	solute carrier family 7 member 5	NM_003486.5		GGATGTGGGGAACATTGTGCTGGCATTATACAGCGGCCTCTTTGCCTATGGAGGATGGAATTACTTGAATTTCGTCACAGAGGAAATGATCAACCCCTAC	endogenous
SMAD2	SMAD family member 2	NM_005901.5		TGCTCAAGCATGTCATAAAGCTTCACCAATCAAGTCCCATGAAAAGACTTAATGTAACAACTCTTCTGTCATAGCATTGTGTGTGGTCCCTATGGACTGT	endogenous
SMAD3	SMAD family member 3	NM_005902.3		TTAAAGGACAGTTGAAAAGGGCAAGAGGAAACCAGGGCAGTTCTAGAGGAGTGCTGGTGACTGGATAGCAGTTTTAAGTGGCGTTCACCTAGTCAACACG	endogenous
SMAD5	SMAD family member 5	NM_005903.5		CCTGATGATCAGATGGGTCAAGATAATTCCCAGCCTATGGATACAAGCAATAATATGATTCCTCAGATTATGCCCAGTATATCCAGCAGGGATGTTCAGC	endogenous
SMARCA4	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	NM_001128849.1		GCAGAAGCACCAGGAATACCTCAATAGCATTCTCCAGCATGCCAAGGATTTCAAGGAATATCACAGATCCGTCACAGGCAAAATCCAGAAGCTGACCAAG	endogenous
SMC2	structural maintenance of chromosomes 2	NM_001042551.1		AAGGACTTGTGGCTTCTCTGATTAGTGTGAAAGACACTTCTGCAACCACAGCTTTAGAATTAGTGGCTGGAGAACGACTCTACAATGTTGTAGTAGACAC	endogenous
SMURF1	SMAD specific E3 ubiquitin protein ligase 1	NM_181349.1		AAGAGAATCTGCCACCAGATCGAATTTCGACCCCTGAGCTTGTTCGGACGTATGGTCCAAATTCAGATTAAGGTGGTCACCCAACCCGAGATGTCAGGAA	endogenous
SOCS2	suppressor of cytokine signaling 2	NM_003877.3		GGAACGGCACTGTTCACCTTTATCTGACCAAACCGCTCTACACGTCAGCACCATCTCTGCAGCATCTCTGTAGGCTCACCATTAACAAATGTACCGGTGC	endogenous
SOCS4	suppressor of cytokine signaling 4	NM_199421.1		TCCTGTGGGCATCGATTTTTAGGCCGATCTCTTAAACAGAAACTGCAAGATGCCGTGGGGCAGTGTTTTCCAATAAAGAATTGTAGTAGTCGGCACTCTT	endogenous
SOCS5	suppressor of cytokine signaling 5	NM_014011.4		GTGTTTCCAGCAGAACTGTAGGAAGTCGCTCTCTAAGACAGAGGTTGCAGGATACTGTGGGCTTGTGTTTTCCCATGAGAACTTACAGCAAGCAGTCAAA	endogenous
SOS2	SOS Ras/Rho guanine nucleotide exchange factor 2	NM_006939.2		AGAGACATTAGTACGTGTCCAAATTCGCCAAGCACTCCTCCTAGCACACCCTCTCCAAGGGTACCGCGTCGATGCTATGTGCTCAGTTCTAGTCAGAATA	endogenous
SP100	SP100 nuclear antigen	NM_003113.3		TGGGGATGCTGGAAGGGAGATGCCCTGCCCGTTGCCCTGTGATGAAGAAAGCCCAGAGGCAGAGCTACACAACCATGGAATCCAAATTAATTCCTGTTCT	endogenous
SPIB	Spi-B transcription factor	NM_003121.3		CTTTGTCATGTACAGACTCCCTGGGATCCTCATGTTTTGGGTGACAGGACCTATGGACCACTATACTCGGGGAGGCAGGGTAGCAGTTCTTCCAGAATCC	endogenous
SRC	SRC proto-oncogene, non-receptor tyrosine kinase	NM_005417.3		GGCATGAGAAGCTGGTGCAGTTGTATGCTGTGGTTTCAGAGGAGCCCATTTACATCGTCACGGAGTACATGAGCAAGGGGAGTTTGCTGGACTTTCTCAA	endogenous
SRR	serine racemase	NM_021947.1		ACAATTGCCCTGGAAGTGCTGAACCAGGTTCCTTTGGTGGATGCACTGGTGGTACCTGTAGGTGGAGGAGGAATGCTTGCTGGAATAGCAATTACAGTTA	endogenous
STAM	signal transducing adaptor molecule	NR_037774.1		CCACTTTGTATCCAAGCACATCCAGTCTCTTAACTAACCACCAACATGAAGGCCGAAAAGTTCGTGCTATATATGACTTTGAAGCTGCTGAAGACAATGA	endogenous
STAT1	signal transducer and activator of transcription 1	NM_139266.1		ACAGTGGTTAGAAAAGCAAGACTGGGAGCACGCTGCCAATGATGTTTCATTTGCCACCATCCGTTTTCATGACCTCCTGTCACAGCTGGATGATCAATAT	endogenous
STAT2	signal transducer and activator of transcription 2	NM_005419.3		GATTTGGGACTTTGGTTACCTGACTCTGGTGGAGCAACGTTCAGGTGGTTCAGGAAAGGGCAGCAATAAGGGGCCACTAGGTGTGACAGAGGAACTGCAC	endogenous
STAT3	signal transducer and activator of transcription 3	NM_003150.3		AAAGAAGGAGGCGTCACTTTCACTTGGGTGGAGAAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTGAACAACA	endogenous
STAT4	signal transducer and activator of transcription 4	NM_003151.2		AGACAATGGATCAGAGTGACAAGAATAGTGCCATGGTGAATCAGGAAGTTTTGACACTGCAGGAAATGCTTAACAGCCTCGATTTCAAGAGAAAGGAGGC	endogenous
STAT5A	signal transducer and activator of transcription 5A	NM_003152.2		GAGACAGAGAGAGAGAAAGAGAGAGTGTGTGGGTCTATGTAAATGCATCTGTCCTCATGTGTTGATGTAACCGATTCATCTCTCAGAAGGGAGGCTGGGG	endogenous
STAT5B	signal transducer and activator of transcription 5B	NM_012448.3		AAGGAGAAGCCCTTCATCAGATGCAAGCGTTATATGGCCAGCATTTTCCCATTGAGGTGCGGCATTATTTATCCCAGTGGATTGAAAGCCAAGCATGGGA	endogenous
STAT6	signal transducer and activator of transcription 6	NM_003153.3		AGAACATCCAGCCATTCTCTGCCAAAGACCTGTCCATTCGCTCACTGGGGGACCGAATCCGGGATCTTGCTCAGCTCAAAAATCTCTATCCCAAGAAGCC	endogenous
STK11	serine/threonine kinase 11	NM_000455.4		GCTGAAGCACCAGTGCCCATCCCACCGAGCCCAGACACCAAGGACCGGTGGCGCAGCATGACTGTGGTGCCGTACTTGGAGGACCTGCACGGCGCGGACG	endogenous
TAOK2	TAO kinase 2	NM_004783.2		TTACAGAAGCTCCGGCATCCCAACACCATTCAGTACCGGGGCTGTTACCTGAGGGAGCACACGGCTTGGCTGGTAATGGAGTATTGCCTGGGCTCAGCTT	endogenous
TBX21	T-box 21	NM_013351.1		ACACAGGAGCGCACTGGATGCGCCAGGAAGTTTCATTTGGGAAACTAAAGCTCACAAACAACAAGGGGGCGTCCAACAATGTGACCCAGATGATTGTGCT	endogenous
TCF7	transcription factor 7	NM_201633.2		GGAGGCCAAGAAGCCAACCATCAAGAAGCCCCTCAATGCCTTCATGCTGTACATGAAGGAGATGAGAGCCAAGGTCATTGCAGAGTGCACACTTAAGGAG	endogenous
TCL1A	T cell leukemia/lymphoma 1A	NR_049726.1		CCCACCCAGATAGGCCCAAGCCTGCTGCCTATCATGTGGCAGCTCTACCCTGATGGACGATACCGATCCTCAGACTCCAGTTTCTGGCGCTTAGTGTACC	endogenous
TERT	telomerase reverse transcriptase	NM_198253.1		GGCTTCAAGGCTGGGAGGAACATGCGTCGCAAACTCTTTGGGGTCTTGCGGCTGAAGTGTCACAGCCTGTTTCTGGATTTGCAGGTGAACAGCCTCCAGA	endogenous
TET2	tet methylcytosine dioxygenase 2	NM_001127208.2		CTCATAATGTCCAAATGGGACTGGAGGAAGTACAGAATATAAATCGTAGAAATTCCCCTTATAGTCAGACCATGAAATCAAGTGCATGCAAAATACAGGT	endogenous
TFAM	transcription factor A, mitochondrial	NM_003201.1		AGGCTCTCCGAGATTGGGGTCGGGTCACTGCCTCATCCACCGGAGCGATGGCGTTTCTCCGAAGCATGTGGGGCGTGCTGAGTGCCCTGGGAAGGTCTGG	endogenous
TFB2M	transcription factor B2, mitochondrial	NM_022366.2		TGGGGTTCACTGTAGTAGCTGCACTAGGTGATTCTTGGAGCGGGCCTGAGAGACAAGGACATGTGGATCCCAGTGGTCGGGCTTCCTCGGCGGCTGAGGC	endogenous
TFDP1	transcription factor Dp-1	NM_007111.4		GCCGCTTATTTGCCGTGAGTTTGGACGGCACCCCTGCTGGCGGATAGCAAGACTCTGTGGAGTTTGTTCAGTGGTACGGTGTCCAAGCAAACAGCAGAAT	endogenous
TFRC	transferrin receptor	NM_003234.1		CAGTTTCCACCATCTCGGTCATCAGGATTGCCTAATATACCTGTCCAGACAATCTCCAGAGCTGCTGCAGAAAAGCTGTTTGGGAATATGGAAGGAGACT	endogenous
TGFB1	transforming growth factor beta 1	NM_000660.3		TATATGTTCTTCAACACATCAGAGCTCCGAGAAGCGGTACCTGAACCCGTGTTGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTCAAGTTAAAAGTGG	endogenous
TGFBR1	transforming growth factor beta receptor 1	NM_004612.2		GAATCCTTCAAACGTGCTGACATCTATGCAATGGGCTTAGTATTCTGGGAAATTGCTCGACGATGTTCCATTGGTGGAATTCATGAAGATTACCAACTGC	endogenous
TGFBR2	transforming growth factor beta receptor 2	NM_001024847.1		ATTTGGAGAATGTTGAGTCCTTCAAGCAGACCGATGTCTACTCCATGGCTCTGGTGCTCTGGGAAATGACATCTCGCTGTAATGCAGTGGGAGAAGTAAA	endogenous
TGIF2	TGFB induced factor homeobox 2	NM_021809.6		GTCAAGCCAGGTGTGGACATTCCAAGTTCATATGCGTGAACAAAAGAAAAGAGGAACCCAGTGGATGTAACAGAACCGACTCCAGTTGAATGTTTAGATT	endogenous
TICAM1	toll like receptor adaptor molecule 1	NM_014261.1		CCCCAGTCTCTCCCCTTGCCTATTCTGGAGCCGGTCAAAAACCCCTGCTCTGTCAAAGACCAGACGCCACTCCAACTTTCTGTAGAAGATACCACCTCTC	endogenous
TIGIT	T cell immunoreceptor with Ig and ITIM domains	NM_173799.2		TGGATCTTAGAAGACTTTTATCCTTCCACCATCTCTCTCAGAGGAATGAGCGGGGAGGTTGGATTTACTGGTGACTGATTTTCTTTCATGGGCCAAGGAA	endogenous
TIMM17A	translocase of inner mitochondrial membrane 17A	NM_006335.2		GTGGTGGGGCCTTTACGATGGGTACCATTGGTGGTGGTATCTTTCAAGCAATCAAAGGTTTTCGCAATTCTCCAGTGGGAGTAAACCACAGACTACGAGG	endogenous
TIMM23	translocase of inner mitochondrial membrane 23	NM_006327.2		CAGCCTCTATGCACTATATAATAACTGGGAGCACATGAAAGGCTCCTTGCTCCAACAGTCACTCTGAAGATTTTGCCAACTCATGAATGGAGGACACTTC	endogenous
TIMP1	TIMP metallopeptidase inhibitor 1	NM_003254.2		CGTGGGGACACCAGAAGTCAACCAGACCACCTTATACCAGCGTTATGAGATCAAGATGACCAAGATGTATAAAGGGTTCCAAGCCTTAGGGGATGCCGCT	endogenous
TKT	transketolase	NM_001064.2		TGTGCCACCCGCAACAGGACGGTGCCCTTCTGCAGCACTTTTGCAGCCTTCTTCACGCGGGCCTTTGACCAGATTCGCATGGCCGCCATCTCCGAGAGCA	endogenous
TLR2	toll like receptor 2	NM_003264.3		CAATGATGCTGCCATTCTCATTCTTCTGGAGCCCATTGAGAAAAAAGCCATTCCCCAGCGCTTCTGCAAGCTGCGGAAGATAATGAACACCAAGACCTAC	endogenous
TLR4	toll like receptor 4	NM_138554.2		ACTCAGAAAAGCCCTGCTGGATGGTAAATCATGGAATCCAGAAGGAACAGTGGGTACAGGATGCAATTGGCAGGAAGCAACATCTATCTGAAGAGGAAAA	endogenous
TLR9	toll like receptor 9	NM_017442.2		ACCTTCTTGGCTGTGCCCACCCTGGAAGAGCTAAACCTGAGCTACAACAACATCATGACTGTGCCTGCGCTGCCCAAATCCCTCATATCCCTGTCCCTCA	endogenous
TNF	tumor necrosis factor	NM_000594.2		AGCAACAAGACCACCACTTCGAAACCTGGGATTCAGGAATGTGTGGCCTGCACAGTGAAGTGCTGGCAACCACTAAGAATTCAAACTGGGGCCTCCAGAA	endogenous
TNFRSF10B	TNF receptor superfamily member 10b	NM_003842.3		GCATCTCCTGCAAATATGGACAGGACTATAGCACTCACTGGAATGACCTCCTTTTCTGCTTGCGCTGCACCAGGTGTGATTCAGGTGAAGTGGAGCTAAG	endogenous
TNFRSF11A	TNF receptor superfamily member 11a	NM_003839.3		AGTACATGTCTTCTAAATGCACTACTACCTCTGACAGTGTATGTCTGCCCTGTGGCCCGGATGAATACTTGGATAGCTGGAATGAAGAAGATAAATGCTT	endogenous
TNFRSF17	TNF receptor superfamily member 17	NM_001192.2		TCTGACCATTGCTTTCCACTCCCAGCTATGGAGGAAGGCGCAACCATTCTTGTCACCACGAAAACGAATGACTATTGCAAGAGCCTGCCAGCTGCTTTGA	endogenous
TNFRSF18	TNF receptor superfamily member 18	NM_148901.1		GCGCTGCTGCCGCGATTACCCGGGCGAGGAGTGCTGTTCCGAGTGGGACTGCATGTGTGTCCAGCCTGAATTCCACTGCGGAGACCCTTGCTGCACGACC	endogenous
TNFRSF4	TNF receptor superfamily member 4	NM_003327.3		CAACTCTGCACCGTTCTAGGTGCCGATGGCTGCCTCCGGCTCTCTGCTTACGTATGCCATGCATACCTCCTGCCCCGCGGGACCACAATAAAAACCTTGG	endogenous
TNFRSF9	TNF receptor superfamily member 9	NM_001561.4		AGATTTGCAGTCCCTGTCCTCCAAATAGTTTCTCCAGCGCAGGTGGACAAAGGACCTGTGACATATGCAGGCAGTGTAAAGGTGTTTTCAGGACCAGGAA	endogenous
TNFSF13B	TNF superfamily member 13b	NM_001145645.2		CCCAACCTTCAAAGTTCAAGTAGTGATATGGATGACTCCACAGAAAGGGAGCAGTCACGCCTTACTTCTTGCCTTAAGAAAAGAGAAGAAATGAAACTGA	endogenous
TNFSF9	TNF superfamily member 9	NM_003811.3		ACGGGGGGCCTGAGCTACAAAGAGGACACGAAGGAGCTGGTGGTGGCCAAGGCTGGAGTCTACTATGTCTTCTTTCAACTAGAGCTGCGGCGCGTGGTGG	endogenous
TOLLIP	toll interacting protein	NM_019009.2		GGAATAGAGCTGTTGATTTAAGGCACACACAATCCCTCACACTGTGGGTTTTTTTTAGAACTTCCCAGACGAAAACTCACGCCCTTGCCCTAACGCGCTT	endogenous
TOMM6	translocase of outer mitochondrial membrane 6	NM_001134493.1		AGCCAAGTAGTTCTAATGCCACCTGTCGTCTTATCATCTGATTGCAGACAAATGGAATCCTGTGCTGAACCCGAATCTTCCAAAAAACAGCCTACAATCT	endogenous
TOX	thymocyte selection associated high mobility group box	NM_014729.2		CACAGTCTCCAATATGCTGGGCCAGGATGGAACACTGCTTTCTAATTCCATTTCTGTGATGCCAGATATACGAAACCCAGAAGGAACTCAGTACAGTTCC	endogenous
TP53	tumor protein p53	NM_000546.2		GGGGAGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTACCTCCCGCCATAAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGAC	endogenous
TPR	translocated promoter region, nuclear basket protein	NM_003292.2		TCTAGTCACTCTGATCTTGGCCAGCTTGCTTCTCAAGGAGGTTTAGGAATGTATGAAACACCCCTGTTCCTAGCTCATGAAGAAGAGTCAGGTGGCCGAA	endogenous
TPSAB1/B2	tryptase beta 1	NM_003294.3		GCAGGTGAAGGTCCCCATAATGGAAAACCACATTTGTGACGCAAAATACCACCTTGGCGCCTACACGGGAGACGACGTCCGCATCGTCCGTGACGACATG	endogenous
TRAC	T cell receptor alpha constant		ENST00000611116.1	AATCCTCCTCCTGAAAGTGGCCGGGTTTAATCTGCTCATGACGCTGCGGCTGTGGTCCAGCTGAGATCTGCAAGATTGTAAGACAGCCTGTGCTCCCTCG	endogenous
TRAF3	TNF receptor associated factor 3	NM_145725.2		GTTGTGCAGAGCAGTTAATGCTGGGACATCTGCTGGTGCATTTAAAAAATGATTGCCATTTTGAAGAACTTCCATGTGTGCGTCCTGACTGCAAAGAAAA	endogenous
TRAF5	TNF receptor associated factor 5	NM_001033910.2		GCCTACATTAAAGATGACACTCTGTTCTTGAAAGTGGCCGTGGACTTAACTGACCTGGAGGATCTCTAGTCACTGTTATGGGGTGATAAGAGGACTTCTT	endogenous
TRAF6	TNF receptor associated factor 6	NM_145803.2		TTGCAAAACGTGAGATTCTTTCTCTGATGGTGAAATGTCCAAATGAAGGTTGTTTGCACAAGATGGAACTGAGACATCTTGAGGATCATCAAGCACATTG	endogenous
TRAT1	T cell receptor associated transmembrane adaptor 1	NM_016388.2		ACAGAGGACACAGAAGGACTTGGCAGCAGGGTGATGACCTGATCATTTGTTGATGGGATGGTGGCTTACCTCTTATTCACAGCTTACACTTATGCATGCC	endogenous
TRAV1-1	T cell receptor alpha variable 1-1		TCRVA_001.1	TACAATGCTCTGGATGGTTTGGAGGAGACAGGTCGTTTTTCTTCATTCCTTAGTCGCTCTGATAGTTATGGTTACCTCCTTCTACAGGAGCTCCAGATGA	endogenous
TRAV1-2	T cell receptor alpha variable 1-2		TCRVA_002.1	TGTCTTACAATGTTCTGGATGGTTTGGAGGAGAAAGGTCGTTTTTCTTCATTCCTTAGTCGGTCTAAAGGGTACAGTTACCTCCTTTTGAAGGAGCTCCA	endogenous
TRAV10	T cell receptor alpha variable 10		TCRVA_016.1	GTGGTATAAGCAAGATACTGGGAGAGGTCCTGTTTCCCTGACAATCATGACTTTCAGTGAGAACACAAAGTCGAACGGAAGATATACAGCAACTCTGGAT	endogenous
TRAV11	T cell receptor alpha variable 11 (pseudogene)		TCRVA_017.1	TATCAGGAGAGAACACTCTTCAATTTCCACTGGTTCCGGCAGGATCCGGGGAGAAGACTTGTGTCTTTGACCTTAATTCAATCAAGCCAGAAGGAGCAGG	endogenous
TRAV12-1	T cell receptor alpha variable 12-1		TCRVA_018.1	CAACAGTGCTTCTCAGTCTTTCTTCTGGTACAGACAGGATTGCAGGAAAGAACCTAAGTTGCTGATGTCCGTATACTCCAGTGGTAATGAAGATGGAAGG	endogenous
TRAV12-2	T cell receptor alpha variable 12-2		TCRVA_019.1	CATTGCCTCTCTCAACTGCACTTACAGTGACCGAGGTTCCCAGTCCTTCTTCTGGTACAGACAATATTCTGGGAAAAGCCCTGAGTTGATAATGTTCATA	endogenous
TRAV12-3	T cell receptor alpha variable 12-3		TCRVA_020.1	AGTGTTCCAGAGGGAGCCATTGTTTCTCTCAACTGCACTTACAGCAACAGTGCTTTTCAATACTTCATGTGGTACAGACAGTATTCCAGAAAAGGCCCTG	endogenous
TRAV13-1	T cell receptor alpha variable 13-1		TCRVA_021.1	CAGCTTATTATAGACATTCGTTCAAATGTGGGCGAAAAGAAAGACCAACGAATTGCTGTTACATTGAACAAGACAGCCAAACATTTCTCCCTGCACATCA	endogenous
TRAV13-2	T cell receptor alpha variable 13-2		TCRVA_022.1	CAGGAGGGTGACAACTCTATTATCAACTGTGCTTATTCAAACAGCGCCTCAGACTACTTCATTTGGTACAAGCAAGAATCTGGAAAAGGTCCTCAATTCA	endogenous
TRAV14	T cell receptor alpha variable 14		TCRVA_023.1	ATGCAACAGAAGGTCGCTACTCATTGAATTTCCAGAAGGCAAGAAAATCCGCCAACCTTGTCATCTCCGCTTCACAACTGGGGGACTCAGCAATGTATTT	endogenous
TRAV16	T cell receptor alpha variable 16		TCRVA_024.1	ATCAAAGGCTTCACTGCTGACCTTAACAAAGGCGAGACATCTTTCCACCTGAAGAAACCATTTGCTCAAGAGGAAGACTCAGCCATGTATTACTGTGCTC	endogenous
TRAV17	T cell receptor alpha variable 17		TCRVA_025.1	TTAATACGTTCAAATGAAAGAGAGAAACACAGTGGAAGATTAAGAGTCACGCTTGACACTTCCAAGAAAAGCAGTTCCTTGTTGATCACGGCTTCCCGGC	endogenous
TRAV18	T cell receptor alpha variable 18		TCRVA_026.1	CTGAAAAGTTCAGAAAACCAGGAGACGGACAGCAGAGGTTTTCAGGCCAGTCCTATCAAGAGTGACAGTTCCTTCCACCTGGAGAAGCCCTCGGTGCAGC	endogenous
TRAV19	T cell receptor alpha variable 19		TCRVA_027.1	GCAAAATGAAATAAGTGGTCGGTATTCTTGGAACTTCCAGAAATCCACCAGTTCCTTCAACTTCACCATCACAGCCTCACAAGTCGTGGACTCAGCAGTA	endogenous
TRAV2	T cell receptor alpha variable 2		TCRVA_003.1	TACCTTCACTTCCCGGGATGTGCACCAAGACTCCTTGTTAAAGGCTCAAAGCCTTCTCAGCAGGGACGATACAACATGACCTATGAACGGTTCTCTTCAT	endogenous
TRAV20	T cell receptor alpha variable 20		TCRVA_028.1	ACACAGTCAGCGGTTTAAGAGGGCTGTTCTGGTATAGGCAAGATCCTGGGAAAGGCCCTGAATTCCTCTTCACCCTGTATTCAGCTGGGGAAGAAAAGGA	endogenous
TRAV21	T cell receptor alpha variable 21		TCRVA_029.1	TGGGAAAGGTCTCACATCTCTGTTGCTTATTCAGTCAAGTCAGAGAGAGCAAACAAGTGGAAGACTTAATGCCTCGCTGGATAAATCATCAGGACGTAGT	endogenous
TRAV22	T cell receptor alpha variable 22		TCRVA_030.1	CAGCTCATCAACCTGTTTTACATTCCCTCAGGGACAAAACAGAATGGAAGATTAAGCGCCACGACTGTCGCTACGGAACGCTACAGCTTATTGTACATTT	endogenous
TRAV23	T cell receptor alpha variable 23		TCRVA_031.1	GAGAACACTGCGTTTGACTACTTTCCATGGTACCAACAATTCCCTGGGAAAGGCCCTGCATTATTGATAGCCATACGTCCAGATGTGAGTGAAAAGAAAG	endogenous
TRAV24	T cell receptor alpha variable 24		TCRVA_032.1	CTCAGTCACTGCATGTTCAGGAGGGAGACAGCACCAATTTCACCTGCAGCTTCCCTTCCAGCAATTTTTATGCCTTACACTGGTACAGATGGGAAACTGC	endogenous
TRAV25	T cell receptor alpha variable 25		TCRVA_033.1	CACAGGTGAATGGACAACAGGTAATGCAAATTCCTCAGTACCAGCATGTACAAGAAGGAGAGGACTTCACCACGTACTGCAATTCCTCAACTACTTTAAG	endogenous
TRAV26-1	T cell receptor alpha variable 26-1		TCRVA_034.1	ACCTGCCTTGTAATCACTCTACCATCAGTGGAAATGAGTATGTGTATTGGTATCGACAGATTCACTCCCAGGGGCCACAGTATATCATTCATGGTCTAAA	endogenous
TRAV26-2	T cell receptor alpha variable 26-2		TCRVA_035.1	GACAAGCATTACTGTACTCCTATCTTTGGGTATTATGGGTGATGCTAAGACCACACAGCCAAATTCAATGGAGAGTAACGAAGAAGAGCCTGTTCACTTG	endogenous
TRAV27	T cell receptor alpha variable 27		TCRVA_036.1	CAGAGCCCTCAGTTTCTAAGCATCCAAGAGGGAGAAAATCTCACTGTGTACTGCAACTCCTCAAGTGTTTTTTCCAGCTTACAATGGTACAGACAGGAGC	endogenous
TRAV29	T cell receptor alpha variable 29		TCRVA_037.1	ACCCTGCTGAAGGTCCTACATTCCTGATATCTATAAGTTCCATTAAGGATAAAAATGAAGATGGAAGATTCACTGTCTTCTTAAACAAAAGTGCCAAGCA	endogenous
TRAV3	T cell receptor alpha variable 3 (gene/pseudogene)		TCRVA_004.1	TCTGCACCCATCTCGATGCTTGCGATGCTCTTCACATTGAGTGGGCTGAGAGCTCAGTCAGTGGCTCAGCCGGAAGATCAGGTCAACGTTGCTGAAGGGA	endogenous
TRAV30	T cell receptor alpha variable 30		TCRVA_038.1	GCTTTATATTCTGTACACTGGTACAGGCAGAAGCATGGTGAAGCACCCGTCTTCCTGATGATATTACTGAAGGGTGGAGAACAGAAGGGTCATGAAAAAA	endogenous
TRAV34	T cell receptor alpha variable 34		TCRVA_039.1	AAAAGTATGGTGAAGGTCTTATCTTCTTGATGATGCTACAGAAAGGTGGGGAAGAGAAAAGTCATGAAAAGATAACTGCCAAGTTGGATGAGAAAAAGCA	endogenous
TRAV35	T cell receptor alpha variable 35		TCRVA_040.1	TTGACCTCAAATGGAAGACTGACTGCTCAGTTTGGTATAACCAGAAAGGACAGCTTCCTGAATATCTCAGCATCCATACCTAGTGATGTAGGCATCTACT	endogenous
TRAV36	T cell receptor alpha variable 36		TCRVA_041.1	AGCCTACTATGGTACAAGCAGGAAAAGAAAGCTCCCACATTTCTATTTATGCTAACTTCAAGTGGAATTGAAAAGAAGTCAGGAAGACTAAGTAGCATAT	endogenous
TRAV38-1	T cell receptor alpha variable 38-1		TCRVA_042.1	TCTCTGTGAACTTCCAGAAAGCAGCCAAATCCTTCAGTCTCAAGATCTCAGACTCACAGCTGGGGGACACTGCGATGTATTTCTGTGCTTTCATGAAGCA	endogenous
TRAV38-2	T cell receptor alpha variable 38-2		TCRVA_043.1	CTTCCTGTGGGCACTTGTGATCTCCACCTGTCTTGAATTTAGCATGGCTCAGACAGTCACTCAGTCTCAACCAGAGATGTCTGTGCAGGAGGCAGAGACC	endogenous
TRAV39	T cell receptor alpha variable 39		TCRVA_044.1	GTGGAGAGCTGAAAGTGGAACAAAACCCTCTGTTCCTGAGCATGCAGGAGGGAAAAAACTATACCATCTACTGCAATTATTCAACCACTTCAGACAGACT	endogenous
TRAV4	T cell receptor alpha variable 4		TCRVA_005.1	CAACAGTTTCCCAGCCAAGGACCACGATTTATTATTCAAGGATACAAGACAAAAGTTACAAACGAAGTGGCCTCCCTGTTTATCCCTGCCGACAGAAAGT	endogenous
TRAV40	T cell receptor alpha variable 40		TCRVA_045.1	TCCTCTCTGGACTTTCTAATTCTGATCTTAATGTTTGGAGGAACCAGCAGCAATTCAGTCAAGCAGACGGGCCAAATAACCGTCTCGGAGGGAGCATCTG	endogenous
TRAV41	T cell receptor alpha variable 41		TCRVA_046.1	GCTTCAGCTAAGCTGTGTAAGTGCCGCCAAAAATGAAGTGGAGCAGAGTCCTCAGAACCTGACTGCCCAGGAAGGAGAATTTATCACAATCAACTGCAGT	endogenous
TRAV5	T cell receptor alpha variable 5		TCRVA_006.1	TTATAAACTGCACTTACACAGACAGCTCCTCCACCTACTTATACTGGTATAAGCAAGAACCTGGAGCAGGTCTCCAGTTGCTGACGTATATTTTTTCAAA	endogenous
TRAV6	T cell receptor alpha variable 6		TCRVA_007.1	AGAGGCCCTGTTTTCTTGCTACTCATACGTGAAAATGAGAAAGAAAAAAGGAAAGAAAGACTGAAGGTCACCTTTGATACCACCCTTAAACAGAGTTTGT	endogenous
TRAV7	T cell receptor alpha variable 7		TCRVA_008.1	AGCTGCACGTACTCTGTCAGTCGTTTTAACAATTTGCAGTGGTACAGGCAAAATACAGGGATGGGTCCCAAACACCTATTATCCATGTATTCAGCTGGAT	endogenous
TRAV8-1	T cell receptor alpha variable 8-1		TCRVA_009.1	TCACTGGAGTTGGGATGCAACTATTCCTATGGTGGAACTGTTAATCTCTTCTGGTATGTCCAGTACCCTGGTCAACACCTTCAGCTTCTCCTCAAGTACT	endogenous
TRAV8-2	T cell receptor alpha variable 8-2		TCRVA_010.1	CACATCAGCGGCCACCCTGGTTAAAGGCATCAACGGTTTTGAGGCTGAATTTAAGAAGAGTGAAACCTCCTTCCACCTGACGAAACCCTCAGCCCATATG	endogenous
TRAV8-3	T cell receptor alpha variable 8-3		TCRVA_011.1	CTGCCAGAGCCCAGTCAGTGACCCAGCCTGACATCCACATCACTGTCTCTGAAGGAGCCTCACTGGAGTTGAGATGTAACTATTCCTATGGGGCAACACC	endogenous
TRAV8-6	T cell receptor alpha variable 8-6		TCRVA_013.1	TTTATCAGGATCCACCCTGGTTAAAGGCATCAACGGTTTTGAGGCTGAATTTAACAAGAGTCAAACTTCCTTCCACTTGAGGAAACCCTCAGTCCATATA	endogenous
TRAV9-1	T cell receptor alpha variable 9-1		TCRVA_014.1	GAATCAATGGAGATTCAGTGGTCCAGACAGAAGGCCAAGTGCTCCCCTCTGAAGGGGATTCCCTGATTGTGAACTGCTCCTATGAAACCACACAGTACCC	endogenous
TRAV9-2	T cell receptor alpha variable 9-2		TCRVA_015.1	TACTCTTACTGCTTGGAAGAACCCGTGGAAATTCAGTGACCCAGATGGAAGGGCCAGTGACTCTCTCAGAAGAGGCCTTCCTGACTATAAACTGCACGTA	endogenous
TRBC1/2	T cell receptor beta constant 2		ENST00000466254.1	GCTGTCAAGTCCAGTTCTACGGGCTCTCGGAGAATGACGAGTGGACCCAGGATAGGGCCAAACCTGTCACCCAGATCGTCAGCGCCGAGGCCTGGGGTAG	endogenous
TRBV10-1	T cell receptor beta variable 10-1(gene/pseudogene)		ENST00000390364.1	TTCTTCTATGTGGCCCTTTGTCTGCTGTGGGCAGGACACAGGGATGCTGAAATCACCCAGAGCCCAAGACACAAGATCACAGAGACAGGAAGGCAGGTGA	endogenous
TRBV10-2	T cell receptor beta variable 10-2		TCRVB_027.1	TGGAATCACCCAGAGCCCAAGATACAAGATCACAGAGACAGGAAGGCAGGTGACCTTGATGTGTCACCAGACTTGGAGCCACAGCTATATGTTCTGGTAT	endogenous
TRBV10-3	T cell receptor beta variable 10-3		TCRVB_028.1	ATCCATTACTCATATGGTGTTAAAGATACTGACAAAGGAGAAGTCTCAGATGGCTATAGTGTCTCTAGATCAAAGACAGAGGATTTCCTCCTCACTCTGG	endogenous
TRBV11-1	T cell receptor beta variable 11-1		TCRVB_029.1	TATTTCTGGCCATGCTACCCTTTACTGGTACCGGCAGATCCTGGGACAGGGCCCGGAGCTTCTGGTTCAATTTCAGGATGAGAGTGTAGTAGATGATTCA	endogenous
TRBV11-2	T cell receptor beta variable 11-2		TCRVB_030.1	TATATCTGGCCATGCTACCCTTTACTGGTACCAGCAGATCCTGGGACAGGGCCCAAAGCTTCTGATTCAGTTTCAGAATAACGGTGTAGTGGATGATTCA	endogenous
TRBV11-3	T cell receptor beta variable 11-3		TCRVB_031.1	AGTCTCCCAGATATAAGATTATAGAGAAAAAACAGCCTGTGGCTTTTTGGTGCAATCCTATTTCTGGCCACAATACCCTTTACTGGTACCTGCAGAACTT	endogenous
TRBV12-3	T cell receptor beta variable 12-3		TCRVB_032.1	CTTTTCTGGTACAGACAGACCATGATGCGGGGACTGGAGTTGCTCATTTACTTTAACAACAACGTTCCGATAGATGATTCAGGGATGCCCGAGGATCGAT	endogenous
TRBV12-5	T cell receptor beta variable 12-5		TCRVB_034.1	AGATGTCAGCCAATTTTAGGCCACAATACTGTTTTCTGGTACAGACAGACCATGATGCAAGGACTGGAGTTGCTGGCTTACTTCCGCAACCGGGCTCCTC	endogenous
TRBV13	T cell receptor beta variable 13		TCRVB_035.1	GCTGCTGGAGTCATCCAGTCCCCAAGACATCTGATCAAAGAAAAGAGGGAAACAGCCACTCTGAAATGCTATCCTATCCCTAGACACGACACTGTCTACT	endogenous
TRBV14	T cell receptor beta variable 14		TCRVB_036.1	TATGCCCAACAATCGATTCTTAGCTGAAAGGACTGGAGGGACGTATTCTACTCTGAAGGTGCAGCCTGCAGAACTGGAGGATTCTGGAGTTTATTTCTGT	endogenous
TRBV15	T cell receptor beta variable 15		TCRVB_037.1	CCCAAAGCTGCTGTTCCACTACTATGACAAAGATTTTAACAATGAAGCAGACACCCCTGATAACTTCCAATCCAGGAGGCCGAACACTTCTTTCTGCTTT	endogenous
TRBV16	T cell receptor beta variable 16 (gene/pseudogene)		TCRVB_038.1	GATTTCCTTCCAGAATGAAAATGTCTTTGATGAAACAGGTATGCCCAAGGAAAGATTTTCAGCTAAGTGCCTCCCAAATTCACCCTGTAGCCTTGAGATC	endogenous
TRBV18	T cell receptor beta variable 18		TCRVB_039.1	TGGTATCGGCAGCTCCCAGAGGAAGGTCTGAAATTCATGGTTTATCTCCAGAAAGAAAATATCATAGATGAGTCAGGAATGCCAAAGGAACGATTTTCTG	endogenous
TRBV19	T cell receptor beta variable 19		TCRVB_040.1	TACTACTCACAGATAGTAAATGACTTTCAGAAAGGAGATATAGCTGAAGGGTACAGCGTCTCTCGGGAGAAGAAGGAATCCTTTCCTCTCACTGTGACAT	endogenous
TRBV2	T cell receptor beta variable 2		TCRVB_001.1	CAGAGAAGTCTGAAATATTCGATGATCAATTCTCAGTTGAAAGGCCTGATGGATCAAATTTCACTCTGAAGATCCGGTCCACAAAGCTGGAGGACTCAGC	endogenous
TRBV20-1	T cell receptor beta variable 20-1		TCRVB_041.1	TGTGAAGATCGAGTGCCGTTCCCTGGACTTTCAGGCCACAACTATGTTTTGGTATCGTCAGTTCCCGAAACAGAGTCTCATGCTGATGGCAACTTCCAAT	endogenous
TRBV24-1	T cell receptor beta variable 24-1		TCRVB_042.1	GTTCTCAGACTAAGGGTCATGATAGAATGTACTGGTATCGACAAGACCCAGGACTGGGCCTACGGTTGATCTATTACTCCTTTGATGTCAAAGATATAAA	endogenous
TRBV25-1	T cell receptor beta variable 25-1		TCRVB_043.1	AACTACACCTCATCCACTATTCCTATGGAGTTAATTCCACAGAGAAGGGAGATCTTTCCTCTGAGTCAACAGTCTCCAGAATAAGGACGGAGCATTTTCC	endogenous
TRBV27	T cell receptor beta variable 27		TCRVB_044.1	CGACAAGACCCAGGGCTGGGCTTAAGGCAGATCTACTATTCAATGAATGTTGAGGTGACTGATAAGGGAGATGTTCCTGAAGGGTACAAAGTCTCTCGAA	endogenous
TRBV28	T cell receptor beta variable 28		TCRVB_045.1	AGGCCTCGTAGATGTGAAAGTAACCCAGAGCTCGAGATATCTAGTCAAAAGGACGGGAGAGAAAGTTTTTCTGGAATGTGTCCAGGATATGGACCATGAA	endogenous
TRBV29-1	T cell receptor beta variable 29-1		TCRVB_046.1	CAAATCAGGGCTCTGAGGCCACATATGAGAGTGGATTTGTCATTGACAAGTTTCCCATCAGCCGCCCAAACCTAACATTCTCAACTCTGACTGTGAGCAA	endogenous
TRBV3-1	T cell receptor beta variable 3-1		TCRVB_002.1	AATACCTGGTCACACAGATGGGAAACGACAAGTCCATTAAATGTGAACAAAATCTGGGCCATGATACTATGTATTGGTATAAACAGGACTCTAAGAAATT	endogenous
TRBV30	T cell receptor beta variable 30 (gene/pseudogene)		TCRVB_047.1	CTGCTCTCTCCTTGCCCTTCTCCTGGGCACTTTCTTTGGGGTCAGATCTCAGACTATTCATCAATGGCCAGCGACCCTGGTGCAGCCTGTGGGCAGCCCG	endogenous
TRBV4-1	T cell receptor beta variable 4-1		TCRVB_003.1	CAGGGCTATGTATTGGTACAAGCAGAAAGCTAAGAAGCCACCGGAGCTCATGTTTGTCTACAGCTATGAGAAACTCTCTATAAATGAAAGTGTGCCAAGT	endogenous
TRBV4-2	T cell receptor beta variable 4-2		TCRVB_004.1	GGGCATAACGCTATGTATTGGTACAAGCAAAGTGCTAAGAAGCCACTGGAGCTCATGTTTGTCTACAACTTTAAAGAACAGACTGAAAACAACAGTGTGC	endogenous
TRBV4-3	T cell receptor beta variable 4-3		TCRVB_005.1	GGTCATAACGCTATGTATTGGTACAAGCAAAGTGCTAAGAAGCCACTGGAGCTCATGTTTGTCTACAGTCTTGAAGAACGGGTTGAAAACAACAGTGTGC	endogenous
TRBV5-1	T cell receptor beta variable 5-1		TCRVB_006.1	TTTGAATACTTCAGTGAGACACAGAGAAACAAAGGAAACTTCCCTGGTCGATTCTCAGGGCGCCAGTTCTCTAACTCTCGCTCTGAGATGAATGTGAGCA	endogenous
TRBV5-4	T cell receptor beta variable 5-4		TCRVB_007.1	CAACACTGTGTCCTGGTACCAACAGGCCCTGGGTCAGGGGCCCCAGTTTATCTTTCAGTATTATAGGGAGGAAGAGAATGGCAGAGGAAACTTCCCTCCT	endogenous
TRBV5-5	T cell receptor beta variable 5-5		TCRVB_008.1	AGAGTGTGTCCTGGTACCAACAGGTCCTGGGTCAGGGGCCCCAGTTTATCTTTCAGTATTATGAGAAAGAAGAGAGAGGAAGAGGAAACTTCCCTGATCG	endogenous
TRBV5-6	T cell receptor beta variable 5-6		TCRVB_009.1	ACACTGTGTCCTGGTACCAACAGGCCCTGGGTCAGGGGCCCCAGTTTATCTTTCAGTATTATGAGGAGGAAGAGAGACAGAGAGGCAACTTCCCTGATCG	endogenous
TRBV5-8	T cell receptor beta variable 5-8		TCRVB_010.1	TATCTCTGGGCACACCAGTGTGTACTGGTACCAACAGGCCCTGGGTCTGGGCCTCCAGTTCCTCCTTTGGTATGACGAGGGTGAAGAGAGAAACAGAGGA	endogenous
TRBV6-1	T cell receptor beta variable 6-1		TCRVB_011.1	GTGCCCAGGATATGAACCATAACTCCATGTACTGGTATCGACAAGACCCAGGCATGGGACTGAGGCTGATTTATTACTCAGCTTCTGAGGGTACCACTGA	endogenous
TRBV6-2	T cell receptor beta variable 6-2 (gene/pseudogene)		TCRVB_012.1	ATGTACTGGTATCGACAAGACCCAGGCATGGGGCTGAGGCTGATTCATTACTCAGTTGGTGAGGGTACAACTGCCAAAGGAGAGGTCCCTGATGGCTACA	endogenous
TRBV6-4	T cell receptor beta variable 6-4		TCRVB_013.1	GGCTAAGGCTCATCCATTATTCAAATACTGCAGGTACCACTGGCAAAGGAGAAGTCCCTGATGGTTATAGTGTCTCCAGAGCAAACACAGATGATTTCCC	endogenous
TRBV6-5	T cell receptor beta variable 6-5		TCRVB_014.1	ATGAATACATGTCCTGGTATCGACAAGACCCAGGCATGGGGCTGAGGCTGATTCATTACTCAGTTGGTGCTGGTATCACTGACCAAGGAGAAGTCCCCAA	endogenous
TRBV6-6	T cell receptor beta variable 6-6		ENST00000390371.1	GCAGTGTGCCCAGGATATGAACCATAACTACATGTACTGGTATCGACAAGACCCAGGCATGGGGCTGAAGCTGATTTATTATTCAGTTGGTGCTGGTATC	endogenous
TRBV6-8	T cell receptor beta variable 6-8		TCRVB_016.1	ATATGAACCATGGATACATGTCCTGGTATCGACAAGACCCAGGCATGGGGCTGAGACTGATTTACTACTCAGCTGCTGCTGGTACTACTGACAAAGAAGT	endogenous
TRBV6-9	T cell receptor beta variable 6-9		TCRVB_017.1	GGCATGGGGCTGAGGCGCATTCATTACTCAGTTGCTGCTGGTATCACTGACAAAGGAGAAGTCCCCGATGGCTACAATGTATCCAGATCAAACACAGAGG	endogenous
TRBV7-2	T cell receptor beta variable 7-2		TCRVB_018.1	CTCAGGTGTGATCCAATTTCAGGTCATACTGCCCTTTACTGGTACCGACAGAGCCTGGGGCAGGGCCTGGAGTTTTTAATTTACTTCCAAGGCAACAGTG	endogenous
TRBV7-3	T cell receptor beta variable 7-3		TCRVB_019.1	GACAAAGCCTGGGGCAGGGCCCAGAGTTTCTAATTTACTTCCAAGGCACGGGTGCGGCAGATGACTCAGGGCTGCCCAACGATCGGTTCTTTGCAGTCAG	endogenous
TRBV7-4	T cell receptor beta variable 7-4 (gene/pseudogene)		TCRVB_020.1	TGATTCAATTTCGGGTCATGTAACCCTTTATTGGTACCGACAGACCCTGGGGCAGGGCTCAGAGGTTCTGACTTACTCCCAGAGTGATGCTCAACGAGAC	endogenous
TRBV7-6	T cell receptor beta variable 7-6		TCRVB_021.1	CTCCCAGGTACAAAGTCACAAAGAGGGGACAGGATGTAGCTCTCAGGTGTGATCCAATTTCGGGTCATGTATCCCTTTATTGGTACCGACAGGCCCTGGG	endogenous
TRBV7-7	T cell receptor beta variable 7-7		TCRVB_022.1	GTCTCCCAGGTACAAAGTCACAAAGAGGGGACAGGATGTAACTCTCAGGTGTGATCCAATTTCGAGTCATGCAACCCTTTATTGGTATCAACAGGCCCTG	endogenous
TRBV7-8	T cell receptor beta variable 7-8		TCRVB_023.1	GACTTATTTCCAGAATGAAGCTCAACTAGACAAATCGGGGCTGCCCAGTGATCGCTTCTTTGCAGAAAGGCCTGAGGGATCCGTCTCCACTCTGAAGATC	endogenous
TRBV7-9	T cell receptor beta variable 7-9		TCRVB_024.1	TCCTCTGCTGGATGGCCCTGTGTCTCCTGGGGGCAGATCACGCAGATACTGGAGTCTCCCAGAACCCCAGACACAAGATCACAAAGAGGGGACAGAATGT	endogenous
TRBV9	T cell receptor beta variable 9		TCRVB_025.1	ACCAGGGCCTCCAGTTCCTCATTCAGTATTATAATGGAGAAGAGAGAGCAAAAGGAAACATTCTTGAACGATTCTCCGCACAACAGTTCCCTGACTTGCA	endogenous
TRDC	T cell receptor delta constant		ENST00000390477.1	AAAGCAACCTTCAAAGAGCTGCCATAAACCCAAAGCCATAGTTCATACCGAGAAGGTGAACATGATGTCCCTCACAGTGCTTGGGCTACGAATGCTGTTT	endogenous
TRDV1	T cell receptor delta variable 1		ENST00000390452.1	ATGCAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCCTTACAGCTAGAAGATTCAGCAAAGTACTT	endogenous
TRDV2	T cell receptor delta variable 2		ENST00000390469.1	CCATGCAGAGGATCTCCTCCCTCATCCATCTCTCTCTCTTCTGGGCAGGAGTCATGTCAGCCATTGAGTTGGTGCCTGAACACCAAACAGTGCCTGTGTC	endogenous
TRDV3	T cell receptor delta variable 3		ENST00000535880.1	GGATAACAGCAGATCAGAAGGTGCAGATTTTACTCAAGGACGGTTTTCTGTGAAACACATTCTGACCCAGAAAGCCTTTCACTTGGTGATCTCTCCAGTA	endogenous
TREM1	triggering receptor expressed on myeloid cells 1	NM_001242589.1		GTTTACTGCGCGTCCGAATGGTCAACCTTCAAGTGGAAGATTCTGGACTGTATCAGTGTGTGATCTACCAGCCTCCCAAGGAGCCTCACATGCTGTTCGA	endogenous
TRGC1	T cell receptor gamma constant 1		ENST00000443402.1	TTTAATTGGATGACATCAAATTGAACATCCAAGGTAAGAAACAGCATGGCAATTGGGCTGTGGAATTCTGTATTGGTTGTAAGAATGGTCCAACACCCCA	endogenous
TRGC2	T cell receptor gamma constant 2		ENST00000436911.1	ATCAAGAAATTATCTTTCCTCCAATAAAGACAGATGTCACCACAGTGGATCCCAAATACAATTATTCAAAGGATGCAAATGATGTCATCACAATGGATCC	endogenous
TRGV2	T cell receptor gamma variable 2		ENST00000426402.1	GCGTCTTCAGTACTATGACTCCTACAACTCCAAGGTTGTGTTGGAATCAGGAGTCAGTCCAGGGAAGTATTATACTTACGCAAGCACAAGGAACAACTTG	endogenous
TRGV3/5	T cell receptor gamma variable 3		ENST00000390346.1	TTCTGTACTATGACGTCTCCACCGCAAGGGATGTGTTGGAATCAGGACTCAGTCCAGGAAAGTATTATACTCATACACCCAGGAGGTGGAGCTGGATATT	endogenous
TRGV4	T cell receptor gamma variable 4		ENST00000390345.1	CTGAGCTCTCCTGGCCCCTGGCTCTCTTCTGCAGAGGGCCTGCTCTCAGCTGCCACAAGAGGGCGCCGGAGAACGGACCTGAGCAAGAGAGGCAGGAGCT	endogenous
TRGV8	T cell receptor gamma variable 8		ENST00000390343.1	ATGACTCCTACAACTCCAGGGTTGTGTTGGAATCAGGAATCAGTCGAGAAAAGTATCATACTTATGCAAGCACAGGGAAGAGCCTTAAATTTATACTGGA	endogenous
TRGV9	T cell receptor gamma variable 9		ENST00000444775.1	TGGCTATGAGCAGACTTTGTTTGAGATCCCATGTCAGACGTACTTGAAAATGTCCAAGAGTTAGCTGGATATGGGTACAGACAGCTTTCGATTTAACTGA	endogenous
TRIM10	tripartite motif containing 10	NM_006778.3		GGATGGGGACATCTTGAGGCAACGGGATGAATTTGATTTGCTGGTTGCTGGGGAGATCTGCCGGTTTAGTGCTCTTATTGAAGAACTGGAGGAGAAGAAT	endogenous
TRIM22	tripartite motif containing 22	NM_006074.3		CCATGACTGTGTGCCCACCGAGCTCCTGAGTGTTCTCATTCCTTTACCCACTTCTGCATAGTAGCCCTTGTGCTGAGACTCAGATTCTGCACCTGAGTTC	endogenous
TRIM25	tripartite motif containing 25	NM_005082.4		GTGAGTATGAGGAATTTAGCCTCTTATAGTGAAATGAGTCCAACTCTGGGCTTTGCTTAGAGGAGAGCTCCTGTCAGGCTTCCTATAATATGAAAAGAAG	endogenous
TRIM26	tripartite motif containing 26	NM_001242783.1		TCCATCTACTGCCCTAATGGGGCTCTTTTCCCACCTCCTGCTGGTTTCCCGAGGGAACTTCTGACCCTGGAGTCCATGAGGGCTCCTTTCCTTTTTGACC	endogenous
TRIM31	tripartite motif containing 31	NM_007028.3		ACCAGGAGATGTTCCACTATTTCTGCGAGGATGATGGGAAGTTCCTCTGTTTTGTGTGTCGTGAATCCAAGGACCACAAATCCCATAATGTCAGCTTGAT	endogenous
TRIM33	tripartite motif containing 33	NM_015906.3		TTCAGAAGTAGCTCAGGCAGGGAAAGCAGTTGCATTGTACTTTGAAGATAAACTCACAGAGATCTACTCAGACAGGACCTTCGCACCTTTGCCAGAGTTT	endogenous
TRIM34	tripartite motif containing 34	NM_130390.2		GAGAAGAGAAAACTTCCTGGAAGTATCAGGTACAAACTGAGAGACAAAGGATACAAACAGAATTTGATCAGCTTAGAAGCATCCTAAATAATGAGGAGCA	endogenous
TSC2	TSC complex subunit 2	NM_000548.3		AGAACTGACTTGCACCTGGCCGTGGTTCCAGTGCTGACAGCATTAATCTCTTACCATAACTACCTGGACAAAACCAAACAGCGCGAGATGGTCTACTGCC	endogenous
TYK2	tyrosine kinase 2	NM_003331.4		GGCTGCTTGCTGAGGGCCGGGGATGACTGCTTCTCTCTGCGTCGCTGTTGCCTGCCCCAACCAGGAGAAACCTCCAATCTCATCATCATGCGGGGGGCTC	endogenous
TYROBP	TYRO protein tyrosine kinase binding protein	NM_003332.3		TCCAGGGTCAGAGGTCGGATGTCTACAGCGACCTCAACACACAGAGGCCGTATTACAAATGAGCCCGAATCATGACAGTCAGCAACATGATACCTGGATC	endogenous
UBA5	ubiquitin like modifier activating enzyme 5	NM_198329.2		ATTGATGAAAAGACTCTGAAACGAGAAGGTGTTTGTGCAGCCAGTCTTCCTACCACTATGGGTGTGGTTGCTGGGATCTTAGTACAAAACGTGTTAAAGT	endogenous
UBE2F	ubiquitin conjugating enzyme E2 F (putative)	NM_080678.1		GATGCAAAATCTCTTAGCTTCTTTCACGAATGTTGGCCCTGCCTAGATGTTGTGAAGCCTCCCAGAATGCATAGAGTCATTCACTGTAGATCTCTTATTG	endogenous
UBE2I	ubiquitin conjugating enzyme E2 I	NM_194260.2		CGCCCAGGAGAGGAAAGCATGGAGGAAAGACCACCCATTTGGTTTCGTGGCTGTCCCAACAAAAAATCCCGATGGCACGATGAACCTCATGAACTGGGAG	endogenous
UBE2V1	ubiquitin conjugating enzyme E2 V1	NM_001257397.1		GACCCAAGAGCCATATCAGTGCTAGCAAAATGGCAGAATTCATATAGCATCAAAGTTGTCCTGCAAGAGCTTCGGCGCCTAATGATGTCTAAAGAAAATA	endogenous
UQCR10	ubiquinol-cytochrome c reductase, complex III subunit X	NM_001003684.1		CGACGTTGACTTCGAAATTGTACTCCCTGCTGTTCCGCAGGACCTCCACCTTCGCCCTCACCATCATCGTGGGCGTCATGTTCTTCGAGCGCGCCTTCGA	endogenous
UQCRQ	ubiquinol-cytochrome c reductase complex III subunit VII	NM_014402.4		AGGAATCCCCAATGTTCTGCGCCGCATTCGGGAGTCTTTCTTTCGCGTGGTGCCGCAGTTTGTAGTGTTTTATCTTATCTACACATGGGGGACTGAAGAG	endogenous
USP15	ubiquitin specific peptidase 15	NM_001252078.1		GGGACACCTGGTACCTAGTCGATAGTCGCTGGTTCAAACAGTGGAAAAAATATGTTGGCTTTGACAGTTGGGACAAATACCAGATGGGAGATCAAAATGT	endogenous
USP18	ubiquitin specific peptidase 18	NM_017414.3		ACGAATGAGCAAGGCGTTTGGGCTCCTGAGGCAAATCTGTCAGTCCATCCTGGCTGAGTCCTCGCAGTCCCCGGCAGATCTTGAAGAAAAGAAGGAAGAA	endogenous
VAV1	vav guanine nucleotide exchange factor 1	NM_005428.2		CCCTGCAACGGTTCCTGAAACCTCAAGACATTGAGATCATCTTTATCAACATTGAGGACCTGCTTCGTGTTCATACTCACTTCCTAAAGGAGATGAAGGA	endogenous
VAV3	vav guanine nucleotide exchange factor 3	NM_001079874.1		GCAGTCAAGCCTTGCCCATGTGTGCCCAAACCAGTAGATTATTCTTGCCAACCCTGGTATGCTGGAGCAATGGAAAGATTGCAAGCAGAGACCGAACTTA	endogenous
VSIR	V-set immunoregulatory receptor	NM_022153.1		CTGGGACACTTCTGAGTATGAAGCGGGATGCTATTAAAAACTACATGGGGAAACAGGTGCAAACCCTGGAGATGGATTGTAAGAGCCAGTTTAAATCTGC	endogenous
WAS	Wiskott-Aldrich syndrome	NM_000377.2		GGCCGAGGAGCACCAGCGGTTCAGCAGAACATACCCTCCACCCTCCTCCAGGACCACGAGAACCAGCGACTCTTTGAGATGCTTGGACGAAAATGCTTGA	endogenous
WDR45	WD repeat domain 45	NM_007075.3		TCCAAGAACGTCAACTCTGTCATTGCCATCTGCGTAGATGGGACCTTCCACAAATATGTCTTCACTCCTGATGGAAACTGCAACAGAGAGGCTTTCGACG	endogenous
XAF1	XIAP associated factor 1	NM_199139.2		GGCTTACTGCCTGCGGTTCCTGGTCCTGTGTCCGGAGTGTGAGGAGCCTGTCCCCAAGGAAACCATGGAGGAGCACTGCAAGCTTGAGCACCAGCAGGCC	endogenous
XCL1/2	X-C motif chemokine ligand 1	NM_002995.2		CCTCACTACCCAGCGACTGCCGGTTAGCAGAATCAAGACCTACACCATCACGGAAGGCTCCTTGAGAGCAGTAATTTTTATTACCAAACGTGGCCTAAAA	endogenous
ZAP70	zeta chain of T cell receptor associated protein kinase 70	NM_001079.3		GGAGCTCAAGGACAAGAAGCTCTTCCTGAAGCGCGATAACCTCCTCATAGCTGACATTGAACTTGGCTGCGGCAACTTTGGCTCAGTGCGCCAGGGCGTG	endogenous
ZBTB16	zinc finger and BTB domain containing 16	NM_006006.4		CATGGTGGACCAGAGCCCTTCAGTCTCCACTTCATTTGGTCTTTCAGCCATGAGTCCCACCAAGGCTGCAGTGGACAGTTTGATGACCATAGGACAGTCT	endogenous
ABCF1	ATP binding cassette subfamily F member 1	NM_001090.2		TCCCGCCAAGCCATGTTAGAAAATGCATCTGACATCAAGCTGGAGAAGTTCAGCATCTCCGCTCATGGCAAGGAGCTGTTCGTCAATGCAGACCTGTACA	housekeeping
G6PD	glucose-6-phosphate dehydrogenase	NM_000402.4		ACATCGCCTGCGTTATCCTCACCTTCAAGGAGCCCTTTGGCACTGAGGGTCGCGGGGGCTATTTCGATGAATTTGGGATCATCCGGGACGTGATGCAGAA	housekeeping
NRDE2	NRDE-2, necessary for RNA interference, domain containing	NM_017970.3		TGGAGGTCCTATGTACAGATTCAGAATAAGTCCCACAGTGCCAGCAAAACCAGGAGATTTTTTGACACAATCACCAGGTCTGCCAAACCCTTGGAGCCTT	housekeeping
OAZ1	ornithine decarboxylase antizyme 1	NM_004152.2		GGTGGGCGAGGGAATAGTCAGAGGGATCACAATCTTTCAGCTAACTTATTCTACTCCGATGATCGGCTGAATGTAACAGAGGAACTAACGTCCAACGACA	housekeeping
POLR2A	RNA polymerase II subunit A	NM_000937.2		TTCCAAGAAGCCAAAGACTCCTTCGCTTACTGTCTTCCTGTTGGGCCAGTCCGCTCGAGATGCTGAGAGAGCCAAGGATATTCTGTGCCGTCTGGAGCAT	housekeeping
SDHA	succinate dehydrogenase complex flavoprotein subunit A	NM_004168.3		AGGGGCAGGCTTGCGAGCTGCATTTGGCCTTTCTGAGGCAGGGTTTAATACAGCATGTGTTACCAAGCTGTTTCCTACCAGGTCACACACTGTTGCAGCA	housekeeping
STK11IP	serine/threonine kinase 11 interacting protein	NM_052902.2		GCTCTGCTTTCTGCCAACTTCAGCTACAATGCACTGACCGCCTTAGACAGCTCCCTGCGCCTCTTGTCAGCTCTGCGTTTCTTGAACCTAAGCCACAATC	housekeeping
TBC1D10B	TBC1 domain family member 10B	NM_015527.3		GCGTTGGCCTGGGGTGGGGGTGCTCGCTTTGTCTTCTGTCCTTTGGTTCTCCTTCCATAATGCTCCTGTACCCAGTTTATTTAAGGGGACATGCACTGGA	housekeeping
TBP	TATA-box binding protein	NM_001172085.1		ACAGTGAATCTTGGTTGTAAACTTGACCTAAAGACCATTGCACTTCGTGCCCGAAACGCCGAATATAATCCCAAGCGGTTTGCTGCGGTAATCATGAGGA	housekeeping
UBB	ubiquitin B	NM_018955.3		ACCTGGTCCTGCGCCTGAGGGGTGGCTGTTAATTCTTCAGTCATGGCATTCGCAGTGCCCAGTGATGGCATTACTCTGCACTATAGCCATTTGCCCCAAC	housekeeping