GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
Platform GPL6480 Query DataSets for GPL6480
Status Public on Feb 11, 2008
Title Agilent-014850 Whole Human Genome Microarray 4x44K G4112F (Probe Name version)
Technology type in situ oligonucleotide
Distribution commercial
Organism Homo sapiens
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at
Catalog number G4112F
Description This multi-pack (4X44K) formatted microarray represents a compiled view of the human genome as it is understood today. The sequence information used to design this product was derived from a broad survey of well known sources such as RefSeq, Goldenpath, Ensembl, Unigene and others. The resulting view of the human genome covers 41K unique genes and transcripts which have been verified and optimized by alignment to the human genome assembly and by Agilent's Empirical Validation process.

*** The ID column includes the Agilent Probe Names. A different version of this platform with the Agilent Feature Extraction feature numbers in the ID column is assigned accession number GPL4133
Submission date Feb 11, 2008
Last update date Jan 23, 2019
Organization Agilent Technologies
Phone 877-424-4536
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
Samples (24276) GSM264878, GSM264879, GSM264880, GSM264881, GSM264882, GSM264883 
Series (915)
GSE10469 Time course progression of BMP4-treated hESC gene expressions under 4 % and 20 % oxygen conditions.
GSE10878 Integrative Genome-wide Analysis of Glioblastoma.
GSE12435 IMR90 4hr bystander experiment 0.5Gy alpha particle strip dish format
Alternative to GPL4133
Alternative to GPL9822
Alternative to GPL16022
Alternative to GPL16297

Data table header descriptions
ID Agilent feature number
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeq Accession number
GB_ACC GenBank Accession number
GENE Entrez Gene ID

Data table
A_23_P100001 A_23_P100001 FALSE NM_207446 NM_207446 400451 FAM174B family with sequence similarity 174, member B Hs.27373 ENST00000557398 ref|NM_207446|ens|ENST00000557398|ens|ENST00000553393|ens|ENST00000327355 chr15:93160848-93160789 hs|15q26.1 Homo sapiens family with sequence similarity 174, member B (FAM174B), mRNA [NM_207446] GO:0016020(membrane)|GO:0016021(integral to membrane) ATCTCATGGAAAAGCTGGATTCCTCTGCCTTACGCAGAAACACCCGGGCTCCATCTGCCA
A_23_P100011 A_23_P100011 FALSE NM_005829 NM_005829 10239 AP3S2 adaptor-related protein complex 3, sigma 2 subunit Hs.632161 ref|NM_005829|ref|NM_001199058|ref|NR_023361|ref|NR_037582 chr15:90378743-90378684 hs|15q26.1 Homo sapiens adaptor-related protein complex 3, sigma 2 subunit (AP3S2), transcript variant 1, mRNA [NM_005829] GO:0005794(Golgi apparatus)|GO:0006886(intracellular protein transport)|GO:0008565(protein transporter activity)|GO:0016020(membrane)|GO:0016192(vesicle-mediated transport)|GO:0030117(membrane coat)|GO:0030659(cytoplasmic vesicle membrane)|GO:0031410(cytoplasmic vesicle) TCAAGTATTGGCCTGACATAGAGTCCTTAAGACAAGCAAAGACAAGCAAGGCAAGCACGT
A_23_P100022 A_23_P100022 FALSE NM_014848 NM_014848 9899 SV2B synaptic vesicle glycoprotein 2B Hs.21754 ENST00000557410 ref|NM_014848|ref|NM_001167580|ens|ENST00000557410|ens|ENST00000330276 chr15:91838329-91838388 hs|15q26.1 Homo sapiens synaptic vesicle glycoprotein 2B (SV2B), transcript variant 1, mRNA [NM_014848] GO:0001669(acrosomal vesicle)|GO:0006836(neurotransmitter transport)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0022857(transmembrane transporter activity)|GO:0030054(cell junction)|GO:0030672(synaptic vesicle membrane)|GO:0031410(cytoplasmic vesicle)|GO:0045202(synapse) ATGTCGGCTGTGGAGGGTTAAAGGGATGAGGCTTTCCTTTGTTTAGCAAATCTGTTCACA
A_23_P100056 A_23_P100056 FALSE NM_194272 NM_194272 348093 RBPMS2 RNA binding protein with multiple splicing 2 Hs.436518 ENST00000300069 ref|NM_194272|ens|ENST00000300069|gb|AK127873|gb|AK124123 chr15:65032375-65032316 hs|15q22.31 Homo sapiens RNA binding protein with multiple splicing 2 (RBPMS2), mRNA [NM_194272] GO:0000166(nucleotide binding)|GO:0003676(nucleic acid binding) CCCTGTCAGATAAGTTTAATGTTTAGTTTGAGGCATGAAGAAGAAAAGGGTTTCCATTCT
A_23_P100074 A_23_P100074 FALSE NM_020371 NM_020371 57099 AVEN apoptosis, caspase activation inhibitor Hs.555966 ENST00000306730 ref|NM_020371|ens|ENST00000306730|gb|AF283508|gb|BC010488 chr15:34158739-34158680 hs|15q14 Homo sapiens apoptosis, caspase activation inhibitor (AVEN), mRNA [NM_020371] GO:0005515(protein binding)|GO:0005622(intracellular)|GO:0005624(membrane fraction)|GO:0006915(apoptosis)|GO:0006916(anti-apoptosis)|GO:0012505(endomembrane system)|GO:0016020(membrane) GACCAGCCAGTTTACAAGCATGTCTCAAGCTAGTGTGTTCCATTATGCTCACAGCAGTAA
A_23_P100092 A_23_P100092 FALSE NM_152455 NM_152455 146050 ZSCAN29 zinc finger and SCAN domain containing 29 Hs.418287 ENST00000396976 ref|NM_152455|ens|ENST00000396976|ens|ENST00000396972|gb|AF525399 chr15:43653388-43653329 hs|15q15.3 Homo sapiens zinc finger and SCAN domain containing 29 (ZSCAN29), mRNA [NM_152455] GO:0003677(DNA binding)|GO:0003700(sequence-specific DNA binding transcription factor activity)|GO:0005622(intracellular)|GO:0005634(nucleus)|GO:0008270(zinc ion binding)|GO:0016032(viral reproduction)|GO:0046872(metal ion binding) AGAGAAACCCTATGGGTGTCATGACTGTGGTAAGTGCTTCAGTAAAAGCTCTGCCCTTAA
A_23_P100103 A_23_P100103 FALSE NM_015289 NM_015289 23339 VPS39 vacuolar protein sorting 39 homolog (S. cerevisiae) Hs.88025 ENST00000348544 ref|NM_015289|ens|ENST00000348544|ens|ENST00000318006|gb|AF280814 chr15:42453027-42452968 hs|15q15.1 Homo sapiens vacuolar protein sorting 39 homolog (S. cerevisiae) (VPS39), mRNA [NM_015289] GO:0005083(small GTPase regulator activity)|GO:0005737(cytoplasm)|GO:0005765(lysosomal membrane)|GO:0005768(endosome)|GO:0015031(protein transport)|GO:0016020(membrane)|GO:0030897(HOPS complex)|GO:0031902(late endosome membrane) TGCATTTGCAAGATACCCCAATGGAGTGGTCGTCCATTACTTCTGTTCCAAAGAGGTAAA
A_23_P100111 A_23_P100111 FALSE NM_007236 NM_007236 11261 CHP calcium binding protein P22 Hs.406234 ENST00000392151 ref|NM_007236|ens|ENST00000392151|ens|ENST00000334660|gb|AK299660 chr15:41571553-41571612 hs|15q15.1 Homo sapiens calcium binding protein P22 (CHP), mRNA [NM_007236] GO:0005509(calcium ion binding)|GO:0005737(cytoplasm)|GO:0005829(cytosol)|GO:0006813(potassium ion transport)|GO:0007264(small GTPase mediated signal transduction)|GO:0015459(potassium channel regulator activity)|GO:0017156(calcium ion-dependent exocytosis)|GO:0045056(transcytosis) TAGAACAGAAAATGAGCATCCGATTTCTTCACTAAAGGAGACCAAACTGTTCCTTGCGGT
A_23_P100127 A_23_P100127 FALSE NM_170589 NM_170589 57082 CASC5 cancer susceptibility candidate 5 Hs.181855 ENST00000260369 ref|NM_170589|ref|NM_144508|ens|ENST00000260369|ens|ENST00000533001 chr15:40917525-40917584 hs|15q15.1 Homo sapiens cancer susceptibility candidate 5 (CASC5), transcript variant 1, mRNA [NM_170589] GO:0000087(M phase of mitotic cell cycle)|GO:0000236(mitotic prometaphase)|GO:0000278(mitotic cell cycle)|GO:0000777(condensed chromosome kinetochore)|GO:0001669(acrosomal vesicle)|GO:0001675(acrosome assembly)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005654(nucleoplasm)|GO:0005694(chromosome)|GO:0005730(nucleolus)|GO:0005829(cytosol)|GO:0006334(nucleosome assembly)|GO:0007059(chromosome segregation)|GO:0008608(attachment of spindle microtubules to kinetochore)|GO:0010923(negative regulation of phosphatase activity)|GO:0034080(CenH3-containing nucleosome assembly at centromere)|GO:0051301(cell division)|GO:0071173(spindle assembly checkpoint) CGGTCTCTAGCAAAGATTCAGGCATTGGATCTGTTGCAGGTAAACTGAACCTAAGTCCTT
A_23_P100133 A_23_P100133 FALSE NM_015251 NM_015251 23300 ATMIN ATM interactor Hs.16349 ENST00000299575 ref|NM_015251|ens|ENST00000299575|gb|AB007891|gb|CR749457 chr16:81079095-81079154 hs|16q23.2 Homo sapiens ATM interactor (ATMIN), mRNA [NM_015251] GO:0005622(intracellular)|GO:0005634(nucleus)|GO:0006974(response to DNA damage stimulus)|GO:0008270(zinc ion binding)|GO:0046872(metal ion binding) TGGACCTTCGTCAGCTTTGACACCTCTTTTCTGATTTAAAGACACCAAGGAAAACTACAA
A_23_P100141 A_23_P100141 FALSE NM_023076 NM_023076 64718 UNKL unkempt homolog (Drosophila)-like Hs.643536 ENST00000397464 ref|NM_023076|ref|NM_001193388|ref|NM_001193389|ens|ENST00000397464 chr16:1415345-1415286 hs|16p13.3 Homo sapiens unkempt homolog (Drosophila)-like (UNKL), transcript variant 3, mRNA [NM_023076] GO:0003676(nucleic acid binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0008270(zinc ion binding)|GO:0016874(ligase activity)|GO:0046872(metal ion binding) AGCAGAGGGGATCCAACGTCAGAGCTTTTAGAATTACTTTTTTAAGCAGCTGTCTTCTGG
A_23_P100156 A_23_P100156 FALSE NM_017849 NM_017849 55654 TMEM127 transmembrane protein 127 Hs.164303 ENST00000432959 ref|NM_017849|ref|NM_001193304|ens|ENST00000432959|ens|ENST00000258439 chr2:96918149-96918090 hs|2q11.2 Homo sapiens transmembrane protein 127 (TMEM127), transcript variant 1, mRNA [NM_017849] GO:0003674(molecular_function)|GO:0005737(cytoplasm)|GO:0005886(plasma membrane)|GO:0008285(negative regulation of cell proliferation)|GO:0016021(integral to membrane)|GO:0032007(negative regulation of TOR signaling cascade) ACCTTCAGTGTAGATCCAGATGGCCAACCTGTCCTTGTTAAGTTACTTGCTTCTTGGGAA
A_23_P100177 A_23_P100177 FALSE NM_002428 NM_002428 4324 MMP15 matrix metallopeptidase 15 (membrane-inserted) Hs.80343 ENST00000219271 ref|NM_002428|ens|ENST00000219271|gb|D85510|gb|BC036495 chr16:58079526-58079585 hs|16q21 Homo sapiens matrix metallopeptidase 15 (membrane-inserted) (MMP15), mRNA [NM_002428] GO:0004222(metalloendopeptidase activity)|GO:0005509(calcium ion binding)|GO:0005515(protein binding)|GO:0005887(integral to plasma membrane)|GO:0006464(protein modification process)|GO:0006508(proteolysis)|GO:0008047(enzyme activator activity)|GO:0008152(metabolic process)|GO:0008233(peptidase activity)|GO:0008270(zinc ion binding)|GO:0016020(membrane)|GO:0031012(extracellular matrix)|GO:0032355(response to estradiol stimulus)|GO:0043085(positive regulation of catalytic activity) GACCATTTGTTTCTGTTTCCCCGACTGGGGCAGGGTGTTTAGAATTTTCTAAATGTAGTT
A_23_P100189 A_23_P100189 FALSE NM_002761 NM_002761 5619 PRM1 protamine 1 Hs.2909 ENST00000312511 ref|NM_002761|ens|ENST00000312511|gb|Y00443|gb|AY651260 chr16:11374862-11374803 hs|16p13.13 Homo sapiens protamine 1 (PRM1), mRNA [NM_002761] GO:0000786(nucleosome)|GO:0003677(DNA binding)|GO:0005634(nucleus)|GO:0005654(nucleoplasm)|GO:0005694(chromosome)|GO:0006323(DNA packaging)|GO:0006997(nucleus organization)|GO:0007275(multicellular organismal development)|GO:0007283(spermatogenesis)|GO:0007286(spermatid development)|GO:0030154(cell differentiation)|GO:0030261(chromosome condensation) GTAGAAGACACTAATTGCACAAAATAGCACATCCACCAAACTCCTGCCTGAGAATGTTAC
A_23_P100196 A_23_P100196 FALSE NM_005153 NM_005153 9100 USP10 ubiquitin specific peptidase 10 Hs.136778 ENST00000219473 ref|NM_005153|ens|ENST00000219473|ens|ENST00000397953|ens|ENST00000540269 chr16:84812831-84812890 hs|16q24.1 Homo sapiens ubiquitin specific peptidase 10 (USP10), mRNA [NM_005153] GO:0002039(p53 binding)|GO:0004221(ubiquitin thiolesterase activity)|GO:0004843(ubiquitin-specific protease activity)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0005769(early endosome)|GO:0006281(DNA repair)|GO:0006508(proteolysis)|GO:0006511(ubiquitin-dependent protein catabolic process)|GO:0008233(peptidase activity)|GO:0008234(cysteine-type peptidase activity)|GO:0016579(protein deubiquitination)|GO:0030330(DNA damage response, signal transduction by p53 class mediator)|GO:0042980(cystic fibrosis transmembrane conductance regulator binding)|GO:0045111(intermediate filament cytoskeleton) TTGGGGTTCGTGCACAACACAGCTTCTGTTGACTCTAACTTCCAAATCAAAATCATTTGG
A_23_P100203 A_23_P100203 FALSE NM_001537 NM_001537 3281 HSBP1 heat shock factor binding protein 1 Hs.250899 ENST00000433866 ref|NM_001537|ens|ENST00000433866|gb|AK172732|gb|BX537440 chr16:83846244-83846303 hs|16q23.3 Homo sapiens heat shock factor binding protein 1 (HSBP1), mRNA [NM_001537] GO:0000122(negative regulation of transcription from RNA polymerase II promoter)|GO:0003714(transcription corepressor activity)|GO:0005634(nucleus)|GO:0005856(cytoskeleton)|GO:0006936(muscle contraction) ACAAATTACATGGGGAACATAAAGGAGTGAGATCCTTCTGTGATAAAATGAATTCACCAC
A_23_P100220 A_23_P100220 FALSE NM_024939 NM_024939 80004 ESRP2 epithelial splicing regulatory protein 2 Hs.592053 ENST00000251366 ref|NM_024939|ens|ENST00000251366|gb|BC030146|gb|BC052309 chr16:68263113-68263054 hs|16q22.1 Homo sapiens epithelial splicing regulatory protein 2 (ESRP2), mRNA [NM_024939] GO:0000166(nucleotide binding)|GO:0003729(mRNA binding)|GO:0005634(nucleus)|GO:0006397(mRNA processing)|GO:0043484(regulation of RNA splicing) CTCAACTGCTGGCTCTTCTTCCCTTTGTATTTGTGTAAGGAGCACTGCACTCCCATAAAA
A_23_P100240 A_23_P100240 FALSE NM_004062 NM_004062 1014 CDH16 cadherin 16, KSP-cadherin Hs.513660 ref|NM_004062|ref|NM_001204744|ref|NM_001204745|ref|NM_001204746 chr16:66942101-66942042 hs|16q22.1 Homo sapiens cadherin 16, KSP-cadherin (CDH16), transcript variant 1, mRNA [NM_004062] GO:0005509(calcium ion binding)|GO:0005886(plasma membrane)|GO:0007155(cell adhesion)|GO:0007156(homophilic cell adhesion)|GO:0016021(integral to membrane) GGGAGTGCTCCAAATGTCAGGGTGTTTGCCCAATAATAAAGCCCCAGAGAACTGGGCTGG
A_23_P10025 A_23_P10025 FALSE NM_006159 NM_006159 4753 NELL2 NEL-like 2 (chicken) Hs.505326 ref|NM_006159|ref|NM_001145108|ref|NM_001145107|ref|NM_001145110 chr12:44902496-44902437 hs|12q12 Homo sapiens NEL-like 2 (chicken) (NELL2), transcript variant 2, mRNA [NM_006159] GO:0005198(structural molecule activity)|GO:0005509(calcium ion binding)|GO:0005515(protein binding)|GO:0005576(extracellular region)|GO:0007155(cell adhesion)|GO:0040008(regulation of growth) ACATCACCATGTAGAAGAATGGGCGTACAGTATATACCGTGACATCCTGAACCCTGGATA
A_23_P100263 A_23_P100263 FALSE NM_198390 NM_198390 80790 CMIP c-Maf inducing protein Hs.594095 ENST00000537098 ref|NM_198390|ref|NM_030629|ens|ENST00000537098|ens|ENST00000539778 chr16:81743583-81743642 hs|16q23.3 Homo sapiens c-Maf inducing protein (CMIP), transcript variant 1, mRNA [NM_198390] GO:0005634(nucleus)|GO:0005737(cytoplasm) CCCCCGCCGAATTCTTTTAGCTTCGTAATTGGAACCTTTGACCTGATCTAAAGTGGACTT

Total number of rows: 41108

Table truncated, full table size 24894 Kbytes.

Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap