NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL30872 Query DataSets for GPL30872
Status Public on Oct 18, 2021
Title MYcroarray CAT-3x20K-Acinetobacter_baumannii_AB5075 v1.0
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Acinetobacter baumannii AB5075
Manufacturer MYcroarray, now Daicel Arbor Biosciences
Manufacture protocol Probes specific to Acinetobacter baumannii AB5075 genes were designed by MYcroarray, Ann Arbor, MI (now Daicel Arbor Biosciences, Ann Arbor, MI) using a proprietary version of the publicly available software OligoArray2.1. One specific probe was designed for each gene, and five technical replicates of each unique probe sequence were included on each array. 45-mer oligonucleotide probes were synthesized in situ, not spotted, on standard size (25mm x 76mm) glass slides using RotoSynth Software Version 1.0. All probes were synthesized on amine-functionalized glass substrates such that the 3' end was covalently coupled to a spacer moiety, which was covalently linked to an amine. The 5’ end of the probe sequence was pushed away from the glass by synthesizing a lawn of poly-deoxythymidine spacers. Three identical 20K arrays were synthesized on each slide so that different samples could be applied independently to each array with the use of gasket slides during hybridization to segregate the replicate arrays. Arrays also included control probes for flour-labelled spike-in control oligos for assessing hybridization and washing stringency.
 
 
Submission date Oct 18, 2021
Last update date Oct 18, 2021
Contact name Kerry S Williamson
E-mail(s) ksw@montana.edu
Organization name Montana State University
Department Microbiology and Immunology
Lab Franklin Lab
Street address 109 Lewis Hall
City Bozeman
State/province Montana
ZIP/Postal code 59717
Country USA
 
Samples (12) GSM5629604, GSM5629605, GSM5629606, GSM5629607, GSM5629608, GSM5629609 
Series (2)
GSE186041 Expression data from Acinetobacter baumannii planktonic, biofilm, and antibiotic treated biofilm samples
GSE186080 Search for a Shared Genetic or Biochemical Basis for Biofilm Tolerance to Antibiotics across Bacterial Species

Data table header descriptions
ID Probe ID from the array manufacturer, MYcroarray
ORF The ABUW number, as found in the PATRIC database and in Gallagher, 2015. Gallagher LA, Ramage E, Weiss EJ, Radey M, Hayden HS, Held KG, Huse HK, Zurawski DV, Brittnacher MJ, Manoil C. Resources for Genetic and Genomic Analysis of Emerging Pathogen Acinetobacter baumannii. J Bacteriol. 2015 Jun 15;197(12):2027-35. doi: 10.1128/JB.00131-15. Epub 2015 Apr 6. PMID: 25845845; PMCID: PMC4438207. Davis JJ, Wattam AR, Aziz RK, Brettin T, Butler R, Butler RM, Chlenski P, Conrad N, Dickerman A, Dietrich EM, Gabbard JL, Gerdes S, Guard A, Kenyon RW, Machi D, Mao C, Murphy-Olson D, Nguyen M, Nordberg EK, Olsen GJ, Olson RD, Overbeek JC, Overbeek R, Parrello B, Pusch GD, Shukla M, Thomas C, VanOeffelen M, Vonstein V, Warren AS, Xia F, Xie D, Yoo H, Stevens R. The PATRIC Bioinformatics Resource Center: expanding data and analysis capabilities. Nucleic Acids Res. 2020 Jan 8;48(D1):D606-D612. doi: 10.1093/nar/gkz943. PMID: 31667520. PMCID: PMC7145515.
GeneRef - NCBI The updated ABUW number, as found in NCBI. National Center for Biotechnology Information (NCBI)[Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; [1988] – [cited Ocgober 15, 2021]. Available from: https://0-www-ncbi-nlm-nih-gov.brum.beds.ac.uk/
product - Mycroarray The description of the protein provided by MYcroarray
protein_id - Mycroarray The WP number provided by MYcroarray
db_xref - Mycroarray The GI number provided by MYroarray
SEQUENCE The sequence of the probe designed by MYcroarray
Protein name - NCBI The name of the protein provided by NCBI (NCBI is referenced above)
Replicon Accession - NCBI The NZ number provided by NCBI
Locus - NCBI The locus tag provided by NCBI
Feature ID - Patric The refseq number provided by PATRIC (PATRIC is referenced above)
Protein ID - Patric The protein ID number provided by PATRIC
Gene Symbol - Patric The locus tag provided by PATRIC
Product - Patric The description of the protein provided by PATRIC
description - (Gallagher, 2015) The description of the protein provided by Gallagher, 2015 (Gallagher, 2015 is referenced above)

Data table
ID ORF GeneRef - NCBI product - Mycroarray protein_id - Mycroarray db_xref - Mycroarray SEQUENCE Protein name - NCBI Replicon Accession - NCBI Locus - NCBI Feature ID - Patric Protein ID - Patric Gene Symbol - Patric Product - Patric description - (Gallagher, 2015)
NZ_CP008706.1_cds_WP_000002862.1_453 ABUW_0484 ABUW_RS02375 terpene utilization protein AtuA WP_000002862.1 GI:445925007 TTAAATGCACTGAATTTTATGTTGGAGAATGCCTTAGGCGGTGGT terpene utilization protein AtuA NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.494759.496564.fwd AKA30261.1 hypothetical protein hypothetical protein
NZ_CP008706.1_cds_WP_000003115.1_1291 ABUW_1370 ABUW_RS06685 hydrolase WP_000003115.1 GI:445925260 GGCTATTTAAAACAGCTTCGCCAAATCATTACACGTTTTATTATC hydrolase NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.1386113.1386745.rev AKA31115.1 hydrolase hydrolase
NZ_CP008706.1_cds_WP_000003406.1_3337 ABUW_3504 ABUW_RS17045 hypothetical protein WP_000003406.1 GI:445925551 AGTTTTGTATGCATTTGGGACATGAACTCCTATTAAAAGAAGAAG MULTISPECIES: hypothetical protein NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.3551389.3551646.rev AKA33198.1 sirA sulfurtransferase TusA sulfurtransferase TusA
NZ_CP008706.1_cds_WP_000003536.1_2863 ABUW_3006 ABUW_RS14590 hypothetical protein WP_000003536.1 GI:445925681 ATGATGAAATAGTTAAAAGACTGCGTAATACAGGATGGCAATGCC hypothetical protein NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.3032324.3033766.rev AKA32719.1 hypothetical protein hypothetical protein
NZ_CP008706.1_cds_WP_000003544.1_3358 ABUW_3525 ABUW_RS17150 polyphosphate--AMP phosphotransferase WP_000003544.1 GI:445925689 TAAGTGGGATGATTATTTAAAGGCGGCCGCAGATATGTTTGAGCG polyphosphate--AMP phosphotransferase NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.3580992.3582410.rev AKA33219.1 pap polyphosphate-AMP phosphotransferase polyphosphate-AMP phosphotransferase
NZ_CP008706.1_cds_WP_000003555.1_2513 ABUW_2642 ABUW_RS12820 HlyD family type I secretion periplasmic adaptor subunit WP_000003555.1 GI:445925700 TGAGAAGACTGTACTGGATTACTTACTTAAACCATTTAATAAAGCC MULTISPECIES: HlyD family type I secretion periplasmic adaptor subunit NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.2639887.2641077.rev AKA32364.1 membrane spanning export protein membrane spanning export protein
NZ_CP008706.1_cds_WP_000003701.1_656 ABUW_0701 ABUW_RS03450 Bcr/CflA family drug resistance efflux transporter WP_000003701.1 GI:445925846 ATGGGAGTGATGATGGTGTTATTTACATTAAGTGGTTTTATTGTTG MULTISPECIES: Bcr/CflA family drug resistance efflux transporter NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.705897.707111.fwd AKA30464.1 "drug resistance transporter, Bcr/CflA subfamily" "drug resistance transporter, Bcr/CflA subfamily"
NZ_CP008706.1_cds_WP_000003709.1_460 ABUW_0491 ABUW_RS02410 stringent starvation protein B WP_000003709.1 GI:445925854 TGCCAATGTAGCGCCTGTAGAAGATAAGTTAGACTCAGAAACACA MULTISPECIES: stringent starvation protein B NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.503901.504329.rev AKA30268.1 sspB stringent starvation protein B stringent starvation protein B
NZ_CP008706.1_cds_WP_000003719.1_2725 ABUW_2859 ABUW_RS13900 cell division protein ZapA WP_000003719.1 GI:445925864 ACGTTTACTCCAGACTATTTTGGAAGATGTTGAACAAATAGTGTA cell division protein ZapA NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.2870334.2870618.fwd AKA32574.1 hypothetical protein hypothetical protein
NZ_CP008706.1_cds_WP_000004112.1_2431 ABUW_2555 ABUW_RS12410 redox-sensitive transcriptional activator SoxR WP_000004112.1 GI:445926257 AATGTCCATTAAGAAATCCAAATGATGTGTTGGGGCAAGAAGGTG MULTISPECIES: redox-sensitive transcriptional activator SoxR NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.2545458.2545910.rev AKA32279.1 soxR redox-sensitive transcriptional activator SoxR redox-sensitive transcriptional activator SoxR
NZ_CP008706.1_cds_WP_000004228.1_1744 ABUW_1843 ABUW_RS08970 quinate dehydrogenase WP_000004228.1 GI:445926373 TTCATCTACAGGTAAAGAGCTGTGGAAGTCACGTATGCCAGTAGGTA quinate dehydrogenase NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.1838999.1841428.fwd AKA31578.1 quiA quinate/shikimate dehydrogenase quinate/shikimate dehydrogenase
NZ_CP008706.1_cds_WP_000004354.1_1469 ABUW_1556 ABUW_RS07595 phosphoenolpyruvate synthase regulatory protein WP_000004354.1 GI:445926499 GCGGGCTATTGAAGGTATTTATATTTCTGAGGGAATTAAATACTT MULTISPECIES: phosphoenolpyruvate synthase regulatory protein NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.1542616.1543452.fwd AKA31294.1 hypothetical protein hypothetical protein
NZ_CP008706.1_cds_WP_000004363.1_1219 ABUW_1296 ABUW_RS06320 hypothetical protein WP_000004363.1 GI:445926508 ATTGTAGTGTTTTTGAGGGTCCAGCGACTATCACGGCAACATTTG hypothetical protein NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.1314234.1314476.fwd AKA31044.1 hypothetical protein hypothetical protein
NZ_CP008706.1_cds_WP_000004552.1_728 ABUW_0778 ABUW_RS03815 hypothetical protein WP_000004552.1 GI:445926697 AAATGGACCCGCAACAATTACTGTAACTTTTGAAGCATATGGTGC MULTISPECIES: hypothetical protein NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.764491.764721.fwd AKA30539.1 hypothetical protein hypothetical protein
NZ_CP008706.1_cds_WP_000004703.1_126 ABUW_0132 ABUW_RS00655 allantoinase WP_000004703.1 GI:445926848 CATGATCGTGTTTGGGTATGTCGCCGTCAGGATATTGCAGAATAT allantoinase NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.146436.147401.rev AKA29927.1 polysaccharide deacetylase polysaccharide deacetylase
NZ_CP008706.1_cds_WP_000004974.1_614 ABUW_0652 ABUW_RS03210 lysine transporter WP_000004974.1 GI:445927119 CTAAATTAATTCCTTACGATCAAATGGATGTAAAACCAGAGCAAG lysine transporter NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.657052.658512.rev AKA30422.1 lysP amino-acid transport protein amino-acid transport protein
NZ_CP008706.1_cds_WP_000005344.1_2089 ABUW_2200 ABUW_RS10695 hypothetical protein WP_000005344.1 GI:445927489 CCAACGGAACATTAACTTGTGCTTTGGTATAATTAGCCTAATATT hypothetical protein NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.2186693.2187340.fwd AKA31928.1 hypothetical protein hypothetical protein
NZ_CP008706.1_cds_WP_000005613.1_1770 ABUW_1869 ABUW_RS09100 NAD-dependent phenylacetaldehyde dehydrogenase WP_000005613.1 GI:445927758 AGAGTTTTCAGATGCCTTTATTGAAGATTACACCGAATTAAAATCG NAD-dependent phenylacetaldehyde dehydrogenase NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.1866737.1868224.fwd AKA31604.1 feaB phenylacetaldehyde dehydrogenase phenylacetaldehyde dehydrogenase
NZ_CP008706.1_cds_WP_000005666.1_2720 ABUW_2854 ABUW_RS13875 FAD-dependent monooxygenase WP_000005666.1 GI:445927811 AGCAAATGGTTTAGGGGCTTTACAAAACACCCAGTATAGTCGTTA FAD-dependent monooxygenase NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.2865221.2866453.rev AKA32569.1 "ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family" "ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family"
NZ_CP008706.1_cds_WP_000006591.1_2068 ABUW_2179 ABUW_RS10590 hypothetical protein WP_000006591.1 GI:445928736 GGTTTTTTGCCATAATCACAACCGCTTTCTTTTTGCAAATTATTG hypothetical protein NZ_CP008706.1 - RefSeq.470.1345.CP008706.CDS.2160924.2161262.rev AKA31907.1 hypothetical protein hypothetical protein

Total number of rows: 3819

Table truncated, full table size 1223 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap