NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL30867 Query DataSets for GPL30867
Status Public on Oct 16, 2021
Title Agilent-059505 MHI_Inflammation_Exon_II_v2 045268
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description Arrays of this design have barcodes that begin with 16059505 or 2559505.
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.
Orientation:
Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).
The ID column represents the Agilent Feature Extraction feature number.
To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.
 
Submission date Oct 15, 2021
Last update date Oct 16, 2021
Contact name John D Rioux
Organization name Montreal Heart Institute
Department Research Center
Lab Genetics and genomic medecine of Inflammation
Street address 5000 Bélanger St.
City Montréal
State/province QC
ZIP/Postal code H1T 1C8
Country Canada
 
Samples (426) GSM5628277, GSM5628278, GSM5628279, GSM5628280, GSM5628281, GSM5628282 
Series (1)
GSE186001 Functional screen of Inflammatory bowel disease genes reveals key epithelial functions: Agilent Targeted Dataset

Data table header descriptions
ID Agilent feature number
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeqAccession
GB_ACC GenBankAccession
LOCUSLINK_ID LocuslinkID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
TIGR_ID TIGRID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Sequence

Data table
ID SPOT_ID CONTROL_TYPE REFSEQ GB_ACC LOCUSLINK_ID GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID TIGR_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE
(+)E1A_r60_1 (+)E1A_r60_1 pos
(+)E1A_r60_3 (+)E1A_r60_3 pos
(+)E1A_r60_a104 (+)E1A_r60_a104 pos
(+)E1A_r60_a107 (+)E1A_r60_a107 pos
(+)E1A_r60_a135 (+)E1A_r60_a135 pos
(+)E1A_r60_a20 (+)E1A_r60_a20 pos
(+)E1A_r60_a22 (+)E1A_r60_a22 pos
(+)E1A_r60_a97 (+)E1A_r60_a97 pos
(+)E1A_r60_n11 (+)E1A_r60_n11 pos
(+)E1A_r60_n9 (+)E1A_r60_n9 pos
3xSLv1 3xSLv1 neg
ABCB1_chr7:87148196_87148279 ABCB1_chr7:87148196_87148279 FALSE ABCB1 ABCB1 chr7:87148220-87148279 GGAAAGTAAACATATCCTGGAATTGCCAAAGGCTTGCAGAACTTAGTACAACACATCTGT
ABCB1_chr7:87160890_87161013 ABCB1_chr7:87160890_87161013 FALSE ABCB1 ABCB1 chr7:87160941-87161000 GGTCTACTTGTAAGTTTATTGAGTTTCTACAGTAAGAATTTCCATGACTTCAGAATGCTG
ABCB1_chr7:87232275_87232456 ABCB1_chr7:87232275_87232456 FALSE ABCB1 ABCB1 chr7:87232397-87232456 TGTCTATACTCTGACAACATTAAAGATTTGCCTCTCTGCTGCAGTCTGTTCTATATGTAT
ADAM29_chr4:175839509-175839622 ADAM29_chr4:175839509-175839622 FALSE ADAM29 ADAM29 chr4:175839547-175839606 TATCTCCTATAAAATAAAAGCTCTCCTGATGGCCTGTTCCTGCACATTTCCTGAGGACGC
AK3_chr9:4741971_4742043 AK3_chr9:4741971_4742043 FALSE AK3 AK3 chr9:4741984-4742043 GAGAGGAAATCCAGCTTCCATTGAGTGAGACTCTTTTATAAATAACGTAAAAGAGTGTGT
AKAP5_chr14:64934850-64941221 AKAP5_chr14:64934850-64941221 FALSE AKAP5 AKAP5 chr14:64940913-64940972 GGTGGTGATCTGAATACAGCAGCAGTTTGAAAGTGTTCCGTTTTTAAATAAACAGTATGC
ANK2_chr4:113970785-113970968 ANK2_chr4:113970785-113970968 FALSE ANK2 ANK2 chr4:113970880-113970939 TCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCA
ARHGAP20_chr11:110561695-110561762 ARHGAP20_chr11:110561695-110561762 FALSE ARHGAP20 ARHGAP20 chr11:110561703-110561762 TTATAATCCAAAATGTCATCCGGGTAGATACTACTATCTTTATTTCACAGGCAAATTTGG
ARHGAP20_chr11:110582381-110582773 ARHGAP20_chr11:110582381-110582773 FALSE ARHGAP20 ARHGAP20 chr11:110582687-110582746 AAGGGCGGGAAGTGTTCTGGGACTCTCATTAGGGGCCGCGAGCCTCGAGCGTCAAATTCC

Total number of rows: 31412

Table truncated, full table size 28344 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL30867_059505_D_GEO_20130820.txt.gz 14.0 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap