NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL30862 Query DataSets for GPL30862
Status Public on Oct 15, 2021
Title Agilent-086360 Shbio Human (4*180K) array
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Agilent Technologies
Manufacture protocol See manufacturer's web site (www.agilent.com).
 
 
Submission date Oct 14, 2021
Last update date Oct 24, 2021
Contact name Zifan Yue
E-mail(s) y459016247@126.com
Phone 15821673019
Organization name Shanghai Changzheng Hospital
Department Ophthalmology
Street address No. 415 Fengyang Road, Hangpu District
City Shanghai
ZIP/Postal code 200001
Country China
 
Samples (6) GSM5627753, GSM5627754, GSM5627755, GSM5627756, GSM5627757, GSM5627758
Series (1)
GSE185952 For lncRNA, circRNA and mRNA sequencing of thyroid-associated ophthalmopathy patients and normal people

Data table header descriptions
ID
ProbeName
Type
GB_ACC RefSeq accession number
TargetID
GeneSymbol
Description
Chromosome
Start
End
Strand
best_transcript
hostgene
SEQUENCE Sequence of probe
SPOT_ID

Data table
ID ProbeName Type GB_ACC TargetID GeneSymbol Description Chromosome Start End Strand best_transcript hostgene SEQUENCE SPOT_ID
A_22_P00001056 A_22_P00001056 mRNA ENST00000497397 RP11-731F5.2 novel transcript [ENST00000497397] chr14 106114261 106115394 - - - TAGGAAGACAAATAGCAGCTGACGGCGTGGGCAAGTCTGCCCACATGTACCGCGCCAAAA ENST00000497397
CUST_25733_PI448380708 CUST_25733_PI448380708 circRNA hsa_circ_0026905 - - chr12 56571805 56581090 - NM_003075 SMARCC2 GCAAGAACAAGTCCAAGACTCCAGAGATTATATACAAGCTGAACCACCCACCAACAAGTC hsa_circ_0026905
CUST_38665_PI448380708 CUST_38665_PI448380708 circRNA hsa_circ_0040454 - - chr16 74372636 74382913 - NR_026950 LOC283922 AGTACTTTGTTCCCCCTGACAAGGCTATTGTGGATGCTGATGGAAGAATTTATATTCGGA hsa_circ_0040454
A_23_P409516 A_23_P409516 mRNA NM_138333 NM_138333 FAM122A Homo sapiens family with sequence similarity 122A (FAM122A), mRNA [NM_138333] chr9 71394981 71400482 + - - TTCCTTTGGATACCCTTGAATTCAGTGTAGTAATATTTTCAGACGTTTCCCCAATAAGTG
CUST_76915_PI448380708 CUST_76915_PI448380708 circRNA hsa_circ_0080265 - - chr7 56120114 56125796 + NM_001762 CCT6A TAACGTGTCATTAGAGTATGAGAAAACGCTCGTTTCTGGCGCTGGAGACATCAAACTTAC hsa_circ_0080265
CUST_33809_PI448380708 CUST_33809_PI448380708 circRNA hsa_circ_0035387 - - chr15 55964642 56032882 - NM_173814 PRTG ATACTCTCAGTGGCTTAGGAGTGTGGTGCTTTAGCGAACTGTCTTTTGTAAAAGAACCAC hsa_circ_0035387
A_23_P34018 A_23_P34018 mRNA NM_001000 NM_001000 RPL39 Homo sapiens ribosomal protein L39 (RPL39), mRNA [NM_001000] chrX 118920467 118925593 - - - TGGCACACATATTTATGCTGTCTGAAGGTCACGATCATGTTACCATATCAAGCTGAAAAT
A_24_P188941 A_24_P188941 mRNA NM_002520 NM_002520 NPM1 Homo sapiens nucleophosmin 1 (NPM1), transcript variant 1, mRNA [NM_002520] chr5 170814708 170837888 + - - AATGTTATGATAGGACATAGTAGTAGCGGTGGTCAGACATGGAAATGGTGGGGAGACAAA
CUST_20427_PI448301858 CUST_20427_PI448301858 lncRNA ENST00000623409 CR381653.1 novel transcript chr21 9325059 9327777 + - - TTCCAGTGTCCTCTGGGTGTTTCCAAGAGCAACAAGAAATGAATAAATCTCTGGTGAGTT ENST00000623409
CUST_18337_PI448380708 CUST_18337_PI448380708 circRNA hsa_circ_0019231 - - chr10 96018556 96022489 + NM_016341 PLCE1 GGAGAACACTGCACTTATGATGAAATCCTCAGCATCATCCAGTGCTTGGAGCAGTAGTAG hsa_circ_0019231
CUST_1104_PI448301858 CUST_1104_PI448301858 lncRNA ENST00000539163 HNF1A-AS1 HNF1A antisense RNA 1 [Source:HGNC Symbol;Acc:HGNC:26785] chr12 120969838 120972292 - - - TAAAAACTTCTGCATATGAAGTCACCCATTCCATTTGACTCTTTAGCCCTCATCCTGGCA ENST00000539163
CUST_15263_PI448380708 CUST_15263_PI448380708 circRNA hsa_circ_0016019 - - chr1 202711518 202718267 - NM_006618 KDM5B CACAGCTGTATGCTCTTCCATGTGTCCTCAGTCAGACACCATTACTAAAGCTGCCATTAG hsa_circ_0016019
CUST_42174_PI448380708 CUST_42174_PI448380708 circRNA hsa_circ_0044097 - - chr17 42929776 42932372 - NM_004247 EFTUD2 TTTCTCTGTCTGTCTTCCACCACTGGCAGGAACAAGATCACCATGATTGCTGAGCCTCTT hsa_circ_0044097
A_33_P3279969 A_33_P3279969 mRNA NM_181775 NM_181775 PLXNA4 Homo sapiens plexin A4 (PLXNA4), transcript variant 2, mRNA [NM_181775] chr7 132169521 132333447 - - - TGCATCTTCATCTTGAAGCAGATAAATGACCGCATTAAGGAGCGGCTGCAGTCTTGTTAC
CUST_105349_PI448380708 CUST_105349_PI448380708 circRNA hsa_circ_0140289 - - chrX 41029247 41076596 + NM_001039590 USP9X CTCTGCCAGTGATTGAGCATTCCGCGGTAAACACCTCTCTTTTGTAGTTCGATTTCCAAA hsa_circ_0140289
CUST_16722_PI448380708 CUST_16722_PI448380708 circRNA hsa_circ_0017537 - - chr10 5014392 5020158 + NM_001353 AKR1C1 TGCTCTCTCCTAAAGATTCTTCACCTAGTGGAATGTCATCCTTACTTCAACCAGAGAAAA hsa_circ_0017537
CUST_22908_PI448380708 CUST_22908_PI448380708 circRNA hsa_circ_0023992 - - chr11 89943703 89947343 - NM_012124 CHORDC1 GATTGGGACCTCATGTAAGAATGGAGGGTGTTCAAAGGGCTGTACAAAAGGTAGACATAA hsa_circ_0023992
CUST_24735_PI448380708 CUST_24735_PI448380708 circRNA hsa_circ_0025878 - - chr12 40034756 40041779 + NM_001031748 C12orf40 TACTCCTCAGAAACTTGCATATGAAAAAAAGCAGAATGACCAGGTCCAGGGTTCTGATCA hsa_circ_0025878
A_33_P3317431 A_33_P3317431 mRNA ENST00000447700 RPL7P59 ribosomal protein L7 pseudogene 59 [Source:HGNC Symbol;Acc:HGNC:49215] [ENST00000447700] chr7 144737092 144738034 - - - GGAACCTGTGTGAAGATCAACAAGGCTTCAATTTACATGCTGAGGATTGTAGAGCCATAG ENST00000447700
CUST_65766_PI448380708 CUST_65766_PI448380708 circRNA hsa_circ_0068608 - - chr3 195781950 195789810 - NM_003234 TFRC ATCTGAACCAATACAGAGCAGACATAAAGATGGGTTTCAGCCCAGCAGAAGCATTATCTT hsa_circ_0068608

Total number of rows: 173079

Table truncated, full table size 36055 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap