NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL29417 Query DataSets for GPL29417
Status Public on Oct 15, 2021
Title NanoString nCounter CAR-T Characterization panel
Technology type other
Distribution custom-commercial
Organism Homo sapiens
Manufacturer NanoString
Manufacture protocol CodeSet Hybridization Setup MAN-10056 (https://www.nanostring.com/download_file/view/863/3778) + nCounter SPRINT® Profiler User Manual MAN-10017 (https://www.nanostring.com/download_file/view/254/3778)
 
 
Submission date Nov 13, 2020
Last update date Oct 15, 2021
Contact name Chrystel Marton
Organization name UMR1098 INSERM
Street address 8 rue du Dr Jean-François-Xavier Girod
City Besançon
ZIP/Postal code 25020
Country France
 
Samples (12) GSM4908559, GSM4908560, GSM4908561, GSM4908562, GSM4908563, GSM4908564 
Series (1)
GSE161483 Nanostring CAR T Characterization panel comparing expression in cord blood-derived transgenic T cells cultured with IL-2 or with IL-7 and IL-15, peripheral blood-derived transgenic T cells cultured with IL-2

Data table header descriptions
ID
DESCRIPTION official gene name
GB_ACC GenBank Accession number
SPOT_ID alternative spot identifier (positive and negative controls)
SEQUENCE RNA sequence targeted by the probe
TYPE Type of probe, endogenous = measured gene, housekeeping gene = used for normalization, positive and negative = internal controls

Data table
ID DESCRIPTION GB_ACC SPOT_ID SEQUENCE TYPE
POS_A ERCC_00117.1 positive
POS_B ERCC_00112.1 positive
POS_C ERCC_00002.1 positive
POS_D ERCC_00092.1 positive
POS_E ERCC_00035.1 positive
POS_F ERCC_00034.1 positive
NEG_A ERCC_00096.1 negative
NEG_B ERCC_00041.1 negative
NEG_C ERCC_00019.1 negative
NEG_D ERCC_00076.1 negative
NEG_E ERCC_00098.1 negative
NEG_F ERCC_00126.1 negative
NEG_G ERCC_00144.1 negative
NEG_H ERCC_00154.1 negative
ACACA acetyl-CoA carboxylase alpha NM_198834.1 GACATGAACACTGTACTGAACTACATCTTCTCTCACGCTCAAGTCACCAAGAAGAATCTTCTGGTCACAATGCTTATTGATCAGTTGTGTGGCCGGGACC endogenous
ACAD10 acyl-CoA dehydrogenase family member 10 NM_001136538.1 AAATGGGGCTCCCTCCCACTGAGAACTGGAACTTCTATATGGCTTTTTCCTTTTTCCGTGTGGCTGCAATCCTACAGGGAGTCTACAAGCGATCACTCAC endogenous
ACADVL acyl-CoA dehydrogenase very long chain NM_001270447.1 ATCTAAGTCCTTTGCTGTGGGAATGTTCAAAGGCCAGCTCACCACAGATCAGGTGTTCCCATACCCGTCCGTGCTCAACGAAGAGCAGACACAGTTTCTT endogenous
ACOT2 acyl-CoA thioesterase 2 NM_006821.4 CTCAGGTCTGAATTCAAAATGGCCTCATCTCCTGCTGTCCTTCGAGCGTCCCGGCTGTACCAATGGAGCCTGAAGAGTTCGGCGCAGTTCCTGGGGTCTC endogenous
ACSF2 acyl-CoA synthetase family member 2 NM_001288968.1 GATCCAGAAATTCAAACTTCGAGAGCAGATGGAACGACATCTAAATCTGTGAATAAAGCAGCAGGCCTGTCCTGGCCGGTTGGCTTGACTCTCTCCTGTC endogenous
ACSL5 acyl-CoA synthetase long chain family member 5 NM_203379.1 CCAACATTGAAAGCAAAGCGAGGAGAGCTTTCCAAATACTTTCGGACCCAAATTGACAGCCTGTATGAGCACATCCAGGATTAGGATAAGGTACTTAAGT endogenous

Total number of rows: 794

Table truncated, full table size 124 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap