NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL28320 Query DataSets for GPL28320
Status Public on Mar 28, 2020
Title Illumina Human Infinium CoreExome-24 Genotyping BeadChip (HumanCoreExome-24 v1.0)
Technology type oligonucleotide beads
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Illumina, Inc.
Manufacture protocol See manufacturer's website
 
 
Submission date Mar 27, 2020
Last update date Mar 28, 2020
Contact name Dake Zhang
E-mail(s) zhangdk@big.ac.cn
Organization name Beijing Institute of Genomics, Chinese Academy of Sciences
Street address NO.1 Beichen West Road, Chaoyang District
City Beijing
ZIP/Postal code 100101
Country China
 
Samples (383) GSM4441842, GSM4441843, GSM4441844, GSM4441845, GSM4441846, GSM4441847 
Series (1)
GSE147673 High copy number variation burdens in cranial meningiomas from patients with diverse clinical phenotypes characterized by hot genomic structure changes

Data table header descriptions
ID
IlmnID
Name ID
IlmnStrand
SNP
AddressA_ID
AlleleA_ProbeSeq
AddressB_ID
AlleleB_ProbeSeq
GenomeBuild
Chr
MapInfo
Ploidy
Species
Source
SourceVersion
SourceStrand
SEQUENCE
TopGenomicSeq
BeadSetID

Data table
ID IlmnID Name IlmnStrand SNP AddressA_ID AlleleA_ProbeSeq AddressB_ID AlleleB_ProbeSeq GenomeBuild Chr MapInfo Ploidy Species Source SourceVersion SourceStrand SEQUENCE TopGenomicSeq BeadSetID
1KG_1_100177980 1KG_1_100177980-0_M_R_2115812812 1KG_1_100177980 MINUS [D/I] 88747340 TTTGGCAGTTCTTCAGCCTCTTCTGGCAGTCTTCAGGCCACCTTTACATG 37 1 100177980 diploid Homo sapiens Unknown 0 PLUS TaaaaTGCaaaattttTCCATTTGaaaaCAGATTAGTTTGCCAACTAATGatatCTACATTAagagAGCATTtataTAGAAAGGctctAAGTACCTTGGGT[-/C]CATGTAAAGGTGGCCTGAAGACTGCCagaagaGGCTgaagaaCTGCCAAAGtcatcaCtataCAGCCGAGGTATGggtggtAACCTGCATGCTAAACAAA TaaaaTGCaaaattttTCCATTTGaaaaCAGATTAGTTTGCCAACTAATGatatCTACATTAagagAGCATTtataTAGAAAGGctctAAGTACCTTGGGT[-/C]CATGTAAAGGTGGCCTGAAGACTGCCagaagaGGCTgaagaaCTGCCAAAGtcatcaCtataCAGCCGAGGTATGggtggtAACCTGCATGCTAAACAAA 837
1KG_1_108681808 1KG_1_108681808-0_P_F_2115829838 1KG_1_108681808 PLUS [D/I] 1735404 CCAGCAACACCATGACTCCAGGGTTTACAGAATCTTTTGCAAAATTATCC 37 1 108681808 diploid Homo sapiens unknown 0 PLUS GCCAATGGGTAGCTGGCCAGCTGACCACAGGTGCTGGATAAGGCACCGCATCCCAGCAACACCATGACTCCAGGGTTTACAGAATCTTTTGCAAAATTAT[-/C]CCAGCCAATAGGACTTCAAGAGCTGCCAGAGAAATAAAGAAGAAAATAATTAACGAACTCTACAACTTCAACGTAAACATTTTCACAGCTATTCTCAACC GCCAATGGGTAGCTGGCCAGCTGACCACAGGTGCTGGATAAGGCACCGCATCCCAGCAACACCATGACTCCAGGGTTTACAGAATCTTTTGCAAAATTAT[-/C]CCAGCCAATAGGACTTCAAGAGCTGCCAGAGAAATAAAGAAGAAAATAATTAACGAACTCTACAACTTCAACGTAAACATTTTCACAGCTATTCTCAACC 837
1KG_1_109440678 1KG_1_109440678-0_M_R_2115829847 1KG_1_109440678 MINUS [I/D] 74776136 CTCACTCATAAAAATCCACGGCTGCCTGCAGAGCATCTCTCACTTCTTCT 37 1 109440678 diploid Homo sapiens Unknown 0 PLUS TAGGTGGgagaAGCAagagCACTTTACAATCTTGGGAAtgtgTATCATGCCAAAGGGaaaaGttttGGTTGCCCTGGTccccAGGATGTAGgagaATTTCC[-/AGA]agaagaAGTgagaGATGctctgcaggcagCCGTGGAttttTAtgagtgagTAggggCTGatatGGGCAGTCATGTAGGCCCATCTAAGCCGTGGATCTGC TAGGTGGgagaAGCAagagCACTTTACAATCTTGGGAAtgtgTATCATGCCAAAGGGaaaaGttttGGTTGCCCTGGTccccAGGATGTAGgagaATTTCC[-/AGA]agaagaAGTgagaGATGctctgcaggcagCCGTGGAttttTAtgagtgagTAggggCTGatatGGGCAGTCATGTAGGCCCATCTAAGCCGTGGATCTGC 837
1KG_1_109479801 1KG_1_109479801-0_M_R_2115829849 1KG_1_109479801 MINUS [D/I] 28674100 CCTTATGCCAAAACGTATGAGGGTAGAAGAGAGATTTTGAGAGAGAGAGA 37 1 109479801 diploid Homo sapiens Unknown 0 PLUS TGGGTaccaccGTGGGATGctctCGTGCctctGCGTCTGGTACATCAAATGCCCGGAGCACTTCAGGGctctTGTTGCCAGTCTGAAAtctcAAGTCAACA[-/TC]tctctctctctcaaaatctctcttctACCCTCATACGttttGGCATAAGGGCCTTGCTCAGTggggCCCATTTGGcccctataATGGAAATCGGCATCAC TGGGTaccaccGTGGGATGctctCGTGCctctGCGTCTGGTACATCAAATGCCCGGAGCACTTCAGGGctctTGTTGCCAGTCTGAAAtctcAAGTCAACA[-/TC]tctctctctctcaaaatctctcttctACCCTCATACGttttGGCATAAGGGCCTTGCTCAGTggggCCCATTTGGcccctataATGGAAATCGGCATCAC 837
1KG_1_110655430 1KG_1_110655430-0_M_R_2115812891 1KG_1_110655430 MINUS [I/D] 27717267 CTTGGCATCCTGTGGTTCAAAGTGTTTAGCTAGGACCAGTCCCAGCTGGT 37 1 110655430 diploid Homo sapiens Unknown 0 PLUS CTACTGCATTGGGCCCAATGCctctATCAATGtcatcaTGCAGCCCTTGgagaAGATGgcgcTAAaggaggCccaccaGCCGCAGACCCAGcccctgtgGC[-/A]ACCAGCTGGGACTGGTCCTAGCTAAacacTTTGAACcacaGGATGCCAAGGCCGtgctgcAgctgctAAGGCAGGAGCACgaggagCGCCTGCagaagaT CTACTGCATTGGGCCCAATGCctctATCAATGtcatcaTGCAGCCCTTGgagaAGATGgcgcTAAaggaggCccaccaGCCGCAGACCCAGcccctgtgGC[-/A]ACCAGCTGGGACTGGTCCTAGCTAAacacTTTGAACcacaGGATGCCAAGGCCGtgctgcAgctgctAAGGCAGGAGCACgaggagCGCCTGCagaagaT 837
1KG_1_11193226 1KG_1_11193226-0_P_F_2115812164 1KG_1_11193226 PLUS [D/I] 49692841 ACTGCAGCACTTTGGGGATTGTGCTCTCATTGATGCCCTGTAGATTCAGC 37 1 11193226 diploid Homo sapiens Unknown 0 PLUS TTCTGATCACCTTGTACCAGCTGCGGTCGTGCTCTGTGGCGGCGCTGTAGTACTGCAGCACTTTGGGGATTGTGCTCTCATTGATGCCCTGTAGATTCAG[-/C]CTGCCACTCTCCAAGTTTCAGGAAGCATCTGGAAGCAGAGAAACAAGCCCCCATGACATTCCCTCCTCAAAACAGCCCTCCTAAGAGGACCACAAATTGT TTCTGATCACCTTGTACCAGCTGCGGTCGTGCTCTGTGGCGGCGCTGTAGTACTGCAGCACTTTGGGGATTGTGCTCTCATTGATGCCCTGTAGATTCAG[-/C]CTGCCACTCTCCAAGTTTCAGGAAGCATCTGGAAGCAGAGAAACAAGCCCCCATGACATTCCCTCCTCAAAACAGCCCTCCTAAGAGGACCACAAATTGT 837
1KG_1_113933669 1KG_1_113933669-0_P_F_2115829870 1KG_1_113933669 PLUS [I/D] 90792342 CCCATGGTGCAGCGGGGTTCGGGATGTCGAAGACGCTGAAGAAGAAGAAG 37 1 113933669 diploid Homo sapiens unknown 0 PLUS CGCCCAGGGccccCGGGCTgagaCggggCCGGAgcggcgccccGgccgcccgcgCggggtctcccccATGGTGCAGCggggTTCGGGATGTCGAAGACGCT[-/GAA]gaagaagaagaaGCACTGGCTCAGCAAGGTGCAGGAGTgcgcCgtgtCCTgggccgggccCCCGGGCGACTTCGgcgcGgagaTCcgcgGTGgcgcGGAG CGCCCAGGGccccCGGGCTgagaCggggCCGGAgcggcgccccGgccgcccgcgCggggtctcccccATGGTGCAGCggggTTCGGGATGTCGAAGACGCT[-/GAA]gaagaagaagaaGCACTGGCTCAGCAAGGTGCAGGAGTgcgcCgtgtCCTgggccgggccCCCGGGCGACTTCGgcgcGgagaTCcgcgGTGgcgcGGAG 837
1KG_1_115258741 1KG_1_115258741-0_M_R_2115829885 1KG_1_115258741 MINUS [D/I] 83784275 CTGGTGTGAAATGACTGAGTACAAACTGGTGGTGGTTGGAGCAGGTGGTG 37 1 115258741 diploid Homo sapiens Unknown 0 PLUS TCAGGTCAGCGGGCTACCACTGGGCCTCACctctAtggtggGATCatatTCATCTACAAAGTGGTTCTGGATTAGCTGGATTGTCAGTgcgcttttCCCAA[-/CACCACCTGCTCCAAC]caccacCTGCTCCAaccaccACCAGTTTGTACTCAGTCATTTcacaCCAGCAAGAACCTGTTGGAAACCAGTAATCAGGGTTAATTGGCGAGCcacaTCT TCAGGTCAGCGGGCTACCACTGGGCCTCACctctAtggtggGATCatatTCATCTACAAAGTGGTTCTGGATTAGCTGGATTGTCAGTgcgcttttCCCAA[-/CACCACCTGCTCCAAC]caccacCTGCTCCAaccaccACCAGTTTGTACTCAGTCATTTcacaCCAGCAAGAACCTGTTGGAAACCAGTAATCAGGGTTAATTGGCGAGCcacaTCT 837
1KG_1_1158675 1KG_1_1158675-0_M_R_2115812093 1KG_1_1158675 MINUS [I/D] 14632273 GGGACGAGTATAAGGTGAAGTTTTTGGCGAGTAAAGGCCATAGCGAGAAG 37 1 1158675 diploid Homo sapiens unknown 0 PLUS acacACAGGATGCCTgagaCCGGTGGCGGGAGCCTGGCTGAGcactcactTTCCTCATCCACTTTGAGTTCCTCGTTGAGCCTGATGGCGTCGGCAACCTC[-/CTT]CTtctcGCTATGGCCTTTACTCGCCaaaaACTTCACCTtataCTCGTCCCAAGacacGTGACCTGGAagagCAGATcacaCCTGTCAGGGCctctGATAC acacACAGGATGCCTgagaCCGGTGGCGGGAGCCTGGCTGAGcactcactTTCCTCATCCACTTTGAGTTCCTCGTTGAGCCTGATGGCGTCGGCAACCTC[-/CTT]CTtctcGCTATGGCCTTTACTCGCCaaaaACTTCACCTtataCTCGTCCCAAGacacGTGACCTGGAagagCAGATcacaCCTGTCAGGGCctctGATAC 837
1KG_1_117644041 1KG_1_117644041-0_P_F_2115812988 1KG_1_117644041 PLUS [D/I] 10618984 GTTTTTTAGATTTGTTTGTGAGGGAACAGTAGAAGAAAAGATCTTACAGC 37 1 117644041 diploid Homo sapiens Unknown 0 PLUS ttattaGAtgtgCTGCTTAGGGttttTGATAGTTTGCTTAttttttgtttttgtttttTAGAtttgtttgTGAGGGAACAGTagaagaAAAGATCTTACAG[-/C]CTCCAAGaaaaaaAGAAAGATTTGGCCAAACAAGTTCTATCAGGGTCTGgagaATCTGTCACCAAGCTCACCTTGGCTGACCTCagagTCCttttTGGCA ttattaGAtgtgCTGCTTAGGGttttTGATAGTTTGCTTAttttttgtttttgtttttTAGAtttgtttgTGAGGGAACAGTagaagaAAAGATCTTACAG[-/C]CTCCAAGaaaaaaAGAAAGATTTGGCCAAACAAGTTCTATCAGGGTCTGgagaATCTGTCACCAAGCTCACCTTGGCTGACCTCagagTCCttttTGGCA 837
1KG_1_118486040 1KG_1_118486040-0_M_R_2115812990 1KG_1_118486040 MINUS [D/I] 77726896 TCCACCAGGTTGTTCTGCAGCAGGAAGACAGCCTTTAACTCTCCGTGAGG 37 1 118486040 diploid Homo sapiens unknown 0 PLUS GTAAAGCCttttCCTGGaaaaAGTAAACCTtgtgAGCTAAGATGGTAGCTAGAACATTTATGattattTTCTTGTACAGGTCCTTTGACTTGattcattcA[-/C]CCTCACGgagaGTTAAAGGCTGTCTTCctgctgCAGaacaacCtggtggAATTGTATTCACTGAatccatccTTGCCTActcctcAGCCTGTCAGGACAA GTAAAGCCttttCCTGGaaaaAGTAAACCTtgtgAGCTAAGATGGTAGCTAGAACATTTATGattattTTCTTGTACAGGTCCTTTGACTTGattcattcA[-/C]CCTCACGgagaGTTAAAGGCTGTCTTCctgctgCAGaacaacCtggtggAATTGTATTCACTGAatccatccTTGCCTActcctcAGCCTGTCAGGACAA 837
1KG_1_11893660 1KG_1_11893660-0_P_F_2115829532 1KG_1_11893660 PLUS [D/I] 82726445 TCCCAATGATACCTACAATGACATGGCCACACTCTTCTTCAACCCGCAGG 37 1 11893660 diploid Homo sapiens unknown 0 PLUS CcttcttCTCAGGTcacaGAAGAtgtgAATTCAAGTATCAAGACAttttttTGTCCCAATGATACCTACAATGACATGGCcacactctTCTTCAACCCGCA[-/G]GGAGTCTGCCAtcctccAGctctTccaccaGGATGGTGAgtgtctgcactgcaGCCCAATCGTGGGTGATTGgtgtCAtctcGGacacAGCCAGGCTTGC CcttcttCTCAGGTcacaGAAGAtgtgAATTCAAGTATCAAGACAttttttTGTCCCAATGATACCTACAATGACATGGCcacactctTCTTCAACCCGCA[-/G]GGAGTCTGCCAtcctccAGctctTccaccaGGATGGTGAgtgtctgcactgcaGCCCAATCGTGGGTGATTGgtgtCAtctcGGacacAGCCAGGCTTGC 837
1KG_1_12066749 1KG_1_12066749-0_P_F_2115829535 1KG_1_12066749 PLUS [D/I] 64756141 CCAGGACCTCCATGGGCATTCTTGTTGTTGGAGGAGTGGTCAGTGACCAG 37 1 12066749 diploid Homo sapiens Unknown 0 PLUS CAGGgctcgctcACCCaggaggAGTTCATGGTTTCCATGGTTACCggcctggcctCCTTGACATCCAGGACCTCCATGGGCATTCttgttgTTggaggaGT[-/GGTCAGTGACCA]GGTCAGTGACCAGTTCTGCTCGGGAAGGTggggGCGGAGGGCAGGTGGGCggggCCTGAGGGCTAGGTTCctgctgTGGccccTGCATTGGGCcacaCTC CAGGgctcgctcACCCaggaggAGTTCATGGTTTCCATGGTTACCggcctggcctCCTTGACATCCAGGACCTCCATGGGCATTCttgttgTTggaggaGT[-/GGTCAGTGACCA]GGTCAGTGACCAGTTCTGCTCGGGAAGGTggggGCGGAGGGCAGGTGGGCggggCCTGAGGGCTAGGTTCctgctgTGGccccTGCATTGGGCcacaCTC 837
1KG_1_12343587 1KG_1_12343587-0_P_F_2115829540 1KG_1_12343587 PLUS [I/D] 84739301 AGAAACATCCAGAATTCTCTTCCAGTTACAATCGAGTTAACCGGAGCATT 37 1 12343587 diploid Homo sapiens unknown 0 PLUS AAagagTAAATTtgatgaTTCCTTAGTCcacaTCAACatatTCTTGGTAGATAAGAAACATCCAGAATtctcTTCCAGTTACAATCGAGTTAACCGGAGCA[-/T]TTGATGTTGAttttAATTGCTTGGAtgtgCTGATcacaCTGCAAACCTGGGTtgtgatatTAGACttttttGGAATCGGCTCCACTGCAGACAACCACGC AAagagTAAATTtgatgaTTCCTTAGTCcacaTCAACatatTCTTGGTAGATAAGAAACATCCAGAATtctcTTCCAGTTACAATCGAGTTAACCGGAGCA[-/T]TTGATGTTGAttttAATTGCTTGGAtgtgCTGATcacaCTGCAAACCTGGGTtgtgatatTAGACttttttGGAATCGGCTCCACTGCAGACAACCACGC 837
1KG_1_12632789 1KG_1_12632789-0_P_F_2115829541 1KG_1_12632789 PLUS [I/D] 44625120 ACCTTTTCAAGATAACGAGGGCATGCATTGTCCATGGGAGGAGGAGGAGG 37 1 12632789 diploid Homo sapiens Unknown 0 PLUS CAGACATGACTAATAGATcacaTGCGTACTTTccccTGACCCagagTGTTCTTTCCCAGccccATACCttttCAAGATAACGAGGgcatgcatTGTCCATG[-/GGA]ggaggaggaggaGGGCCTGGTTGAGCTGcacaGCTTCCACTGtcctccGGGCCACCGtctcCGGCTTCAGTggggGAAagagGTTGGGAAACCTGAacac CAGACATGACTAATAGATcacaTGCGTACTTTccccTGACCCagagTGTTCTTTCCCAGccccATACCttttCAAGATAACGAGGgcatgcatTGTCCATG[-/GGA]ggaggaggaggaGGGCCTGGTTGAGCTGcacaGCTTCCACTGtcctccGGGCCACCGtctcCGGCTTCAGTggggGAAagagGTTGGGAAACCTGAacac 837
1KG_1_1323216 1KG_1_1323216-0_M_R_2115829506 1KG_1_1323216 MINUS [I/D] 66728290 TCCTGTCCTGTTCACAGCTTGCCAAAGGGGCGAGAGAGTCGGAGTCGGAG 37 1 1323216 diploid Homo sapiens unknown 0 PLUS AccccGGTATCGGcctcctGGGTgcgcCCTGAGGcacaCAcctcctCTTAGgagaCGCTGATCGGGATggggACCTCGAGTAGctctGCTCACGGCTCCGG[-/CTCCGA]ctccgactccgactctCTCGccccTTTGGCAAGCtgtgAacaggacaggAGCCAGTTACAAAGCAGAAGTCCCTCCAGCCAACCCTGACAGCCACCTGGG AccccGGTATCGGcctcctGGGTgcgcCCTGAGGcacaCAcctcctCTTAGgagaCGCTGATCGGGATggggACCTCGAGTAGctctGCTCACGGCTCCGG[-/CTCCGA]ctccgactccgactctCTCGccccTTTGGCAAGCtgtgAacaggacaggAGCCAGTTACAAAGCAGAAGTCCCTCCAGCCAACCCTGACAGCCACCTGGG 837
1KG_1_14106394 1KG_1_14106394-0_M_R_2115829547 1KG_1_14106394 MINUS [D/I] 99749212 ACAAACAGGACCTAATTTAGCTATTTCAGTTGCTGAAATCCCTGCAGGAG 37 1 14106394 diploid Homo sapiens Unknown 0 PLUS TCTTAGCatatcaacaaCagagGCAgtgtCTTTCcacaAagagaaaagtgtTTATTTGtcatcaAAGCTCAaacaacttcttcAAACCCAAGATAAACTAA[-/CTC]CTCCTGCAGGGATTTCAGCAACTGAAATAGCTAAATTAGGTCCTGTTtgtgTGTCTGCTCCTGCATCAATGTTGCCtgtgACCTCAAGTAGGTTTAagag TCTTAGCatatcaacaaCagagGCAgtgtCTTTCcacaAagagaaaagtgtTTATTTGtcatcaAAGCTCAaacaacttcttcAAACCCAAGATAAACTAA[-/CTC]CTCCTGCAGGGATTTCAGCAACTGAAATAGCTAAATTAGGTCCTGTTtgtgTGTCTGCTCCTGCATCAATGTTGCCtgtgACCTCAAGTAGGTTTAagag 837
1KG_1_145562155 1KG_1_145562155-0_M_R_2115829903 1KG_1_145562155 MINUS [D/I] 38744875 TAACTCCTCCAGCAAGTTACTGTTGCTCAGTCTCAGTACTGACATCTCCT 37 1 145562155 diploid Homo sapiens unknown 0 PLUS TGAagagAAGgagaAAAGGGTTCCTggggCTCgaggagAGCctctAggggCCCTTGGAggggaaaaGGCCCTaggaggCCTGGCAAAGGGACAGCTGgaga[-/AGG]AGgagaTGTCAGTactgagactgagCAACAGTAACTTGCTggaggaGTTAggggAGTTggggCGGGAGCGGCagagGTTGCagagGGAGCTACAGTCCCT TGAagagAAGgagaAAAGGGTTCCTggggCTCgaggagAGCctctAggggCCCTTGGAggggaaaaGGCCCTaggaggCCTGGCAAAGGGACAGCTGgaga[-/AGG]AGgagaTGTCAGTactgagactgagCAACAGTAACTTGCTggaggaGTTAggggAGTTggggCGGGAGCGGCagagGTTGCagagGGAGCTACAGTCCCT 837
1KG_1_146687322 1KG_1_146687322-0_P_F_2115829912 1KG_1_146687322 PLUS [D/I] 15686837 TTACTTGGCAAACAACTTCAAACACAAAGATACCCACACAATTTTCTACC 37 1 146687322 diploid Homo sapiens Unknown 0 PLUS AATCAAGCCAATCTTTAGAAGTAAACATAGGTAACTGAAACCACGTTATTCATTTACTTGGCAaacaacTTCAAacacAAAGATACCcacaCAAttttCTA[-/C]CCTTAAATCGAatatACTTTAGAAGGTCAAATTCTTTGGCATACATCCTGAAATACTCCAGGACCTGGGCATTATGCATGAAGTTGGGATAATGATCTGG AATCAAGCCAATCTTTAGAAGTAAACATAGGTAACTGAAACCACGTTATTCATTTACTTGGCAaacaacTTCAAacacAAAGATACCcacaCAAttttCTA[-/C]CCTTAAATCGAatatACTTTAGAAGGTCAAATTCTTTGGCATACATCCTGAAATACTCCAGGACCTGGGCATTATGCATGAAGTTGGGATAATGATCTGG 837
1KG_1_150201529 1KG_1_150201529-0_P_F_2115829922 1KG_1_150201529 PLUS [I/D] 28765207 GCAGTAGTTCAAAAATACTTTCTCTATAATCTTCCAGGTTTGTGATCTCA 37 1 150201529 diploid Homo sapiens Unknown 0 PLUS CCGgcgcTTCATTAtcctccTGATCAAATCCATCTAAGTAtgtgATTtgctgcagtagtTCaaaaATACTTtctctataATCTTCCAGGTTtgtgAtctcA[-/T]CAGTTAAACAGGTCAAGACttttCAAAttttTAAGAttttGCTGGaaaaGTAAAGTTaaaaCTTACATTCAAGATTTaaaaTACCATGTTATTTCttttT CCGgcgcTTCATTAtcctccTGATCAAATCCATCTAAGTAtgtgATTtgctgcagtagtTCaaaaATACTTtctctataATCTTCCAGGTTtgtgAtctcA[-/T]CAGTTAAACAGGTCAAGACttttCAAAttttTAAGAttttGCTGGaaaaGTAAAGTTaaaaCTTACATTCAAGATTTaaaaTACCATGTTATTTCttttT 837

Total number of rows: 592617

Table truncated, full table size 277504 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap