NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL28098 Query DataSets for GPL28098
Status Public on Oct 02, 2020
Title Illumina HumanHT-12 V4.0 expression beadchip [HumanHT-12_V4_0_R0_15002873_4.bgx]
Technology type oligonucleotide beads
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Illumina Inc.
Manufacture protocol see manufacturer's website
 
Description ***The annotation table is provided by the submitter and is based on HumanHT-12_V4_0_R0_15002873_4.bgx
 
Submission date Jan 30, 2020
Last update date Oct 02, 2020
Contact name Supriyo De
Organization name NIA-IRP, NIH
Department Laboratory of Genetics and Genomics
Lab Computational Biology & Genomics Core
Street address 251 Bayview Blvd
City Baltimore
State/province Maryland
ZIP/Postal code 21224
Country USA
 
Samples (64) GSM4290826, GSM4290827, GSM4290828, GSM4290829, GSM4290830, GSM4290831 
Series (3)
GSE144557 Cockayne syndrome proteins CSA and CSB maintain mitochondrial homeostasis through NAD+ signaling [HumanHT-12 V4.0]
GSE144558 Cockayne syndrome proteins CSA and CSB maintain mitochondrial homeostasis through NAD+ signaling
GSE149256 The Association between Poverty and Gene Expression within Immune Cells in a Diverse Baltimore City Cohort
Relations
Alternative to GPL10558 (official)

Data table header descriptions
ID PROBE_ID
ARRAY_ADDRESS_ID Decoder id
TRANSCRIPT Internal transcript id
ILMN_GENE Internal gene symbol
PA_Call
TARGETID
SPECIES
SOURCE Transcript sequence source name
SEARCH_KEY Internal id useful for custom design array
SOURCE_REFERENCE_ID Id in the source database
REFSEQ_ID Refseq id
UNIGENE_ID Unigene id
ENTREZ_GENE_ID Entrez gene id
GI Genbank id
ACCESSION Genbank accession number
SYMBOL Gene symbol from the source database
PROTEIN_PRODUCT Genbank protein accession number
PROBE_TYPE Information about what this probe is targeting
PROBE_START Position of the probe relative to the 5' of the source transcript sequence
SEQUENCE Probe sequence
CHROMOSOME
PROBE_CHR_ORIENTATION Orientation on the NCBI genome built
PROBE_COORDINATES genomic position of the probe on the NCBI genome build 36 version 3
CYTOBAND
DEFINITION GGene description from the sourceene description from the source
ONTOLOGY_COMPONENT Cellular component annotations from Gene Ontology project
ONTOLOGY_PROCESS Biological process annotations from Gene Ontology project
ONTOLOGY_FUNCTION Molecular function annotations from Gene Ontology project
SYNONYMS Gene symbol synonyms from Refseq
OBSOLETE_PROBE_ID Identifier of probe id before bgx time
GB_ACC

Data table
ID ARRAY_ADDRESS_ID TRANSCRIPT ILMN_GENE PA_Call TARGETID SPECIES SOURCE SEARCH_KEY SOURCE_REFERENCE_ID REFSEQ_ID UNIGENE_ID ENTREZ_GENE_ID GI ACCESSION SYMBOL PROTEIN_PRODUCT PROBE_TYPE PROBE_START SEQUENCE CHROMOSOME PROBE_CHR_ORIENTATION PROBE_COORDINATES CYTOBAND DEFINITION ONTOLOGY_COMPONENT ONTOLOGY_PROCESS ONTOLOGY_FUNCTION SYNONYMS OBSOLETE_PROBE_ID GB_ACC
ILMN_1343061 2900397 ILMN_160461 CY3_HYB:HIGH_1_MM2 1 CY3_HYB:HIGH_1_MM2 ILMN Controls ILMN_Controls cy3_hyb:high_1_mm2 cy3_hyb:high_1_mm2 cy3_hyb:high_1_mm2 cy3_hyb:high_1_mm2 S 1 AATTAAAACGATGCACTCAGGGTTTAGCGCGTAGACGTATTGCATTATGC
ILMN_1343291 3450719 ILMN_137991 EEF1A1 1 EEF1A1 Homo sapiens RefSeq NM_001402.4 NM_001402.4 NM_001402.4 1915 25453469 NM_001402.4 EEF1A1 NP_001393.1 S 1293 TGTGTTGAGAGCTTCTCAGACTATCCACCTTTGGGTCGCTTTGCTGTTCG 6 - 74284362-74284378:74284474-74284506 6q13c Homo sapiens eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) mRNA. All of the contents of a cell excluding the plasma membrane and nucleus but including other subcellular structures [goid 5737] [evidence NAS] The chemical reactions and pathways resulting in the formation of a protein. This is a ribosome-mediated process in which the information in messenger RNA (mRNA) is used to specify the sequence of amino acids in the protein [goid 6412] [evidence IEA]; The successive addition of amino acid residues to a nascent polypeptide chain during protein biosynthesis [goid 6414] [pmid 3570288] [evidence NAS] Interacting selectively with a nucleotide NM_001402.4
ILMN_1343295 4490161 ILMN_137405 GAPDH 1 GAPDH Homo sapiens RefSeq NM_002046.2 NM_002046.2 2597 7669491 NM_002046.2 GAPDH NP_002037.2 S 930 CTTCAACAGCGACACCCACTCCTCCACCTTTGACGCTGGGGCTGGCATTG 12 + 6517340-6517389 12p13.31d Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. All of the contents of a cell excluding the plasma membrane and nucleus but including other subcellular structures [goid 5737] [evidence NAS] The chemical reactions and pathways involving glucose the aldohexose gluco-hexose. D-glucose is dextrorotatory and is sometimes known as dextrose; it is an important source of energy for living organisms and is found free as well as combined in homo- and hetero-oligosaccharides and polysaccharides [goid 6006] [evidence IEA]; The chemical reactions and pathways resulting in the breakdown of a monosaccharide (generally glucose) into pyruvate NM_002046.2
ILMN_1343321 5390750 ILMN_160027 NEGATIVE_0971 0 NEGATIVE_0971 ILMN Controls ILMN_Controls negative_0971 negative_0971 negative_0971 negative_0971 S 1 TCCCTACTGTAAGCTGGAGGGTAGAATGGGGTCGACGGGGCGCTCTTAAT
ILMN_1343339 4780100 ILMN_160401 NEGATIVE_0953 0 NEGATIVE_0953 ILMN Controls ILMN_Controls negative_0953 negative_0953 negative_0953 negative_0953 S 1 ACGTGGCGGTGGTGTCCTTCGGTTTTAGTGCATCTCCGTCCTCTTCCCCT
ILMN_1343553 2190427 ILMN_159920 NEGATIVE_0717 0 NEGATIVE_0717 ILMN Controls ILMN_Controls negative_0717 negative_0717 negative_0717 negative_0717 S 1 TCCCAGCGGAGCGGTACGCCTGCCTGCCCTAGAGAGTTAAATAGTGGTAA
ILMN_1343567 5910142 ILMN_160278 NEGATIVE_0701 1 NEGATIVE_0701 ILMN Controls ILMN_Controls negative_0701 negative_0701 negative_0701 negative_0701 S 1 CTGTTATCCCCCTGCGGCCTTCACGGTGCCTTTCCCCCCTGTCCTACTAT
ILMN_1343638 2490575 ILMN_160247 NEGATIVE_0615 0 NEGATIVE_0615 ILMN Controls ILMN_Controls negative_0615 negative_0615 negative_0615 negative_0615 S 1 GCCTGTAGGGGCGGTTGTGCACCTTGCAAGCAAGTAACCCACCTTCTCCC
ILMN_1343668 840193 ILMN_160230 NEGATIVE_0575 0 NEGATIVE_0575 ILMN Controls ILMN_Controls negative_0575 negative_0575 negative_0575 negative_0575 S 1 TCTGCGCGCGCGATTACTGACAATCCGCCGCGACAACACCACCTCCAAAG
ILMN_1343782 3060193 ILMN_160180 NEGATIVE_0458 1 NEGATIVE_0458 ILMN Controls ILMN_Controls negative_0458 negative_0458 negative_0458 negative_0458 S 1 GAGTGAGGGGGATTGGATCCTAACGTCCTTGGGTGGGCGTACTTGGCTCA
ILMN_1343835 5290731 ILMN_160155 NEGATIVE_0393 0 NEGATIVE_0393 ILMN Controls ILMN_Controls negative_0393 negative_0393 negative_0393 negative_0393 S 1 GGGCAAGTTTGCGCAGCTAATGGTCAGGGGGGAGGTACTCTCATGGTCAA
ILMN_1343841 6550192 ILMN_160151 NEGATIVE_0386 0 NEGATIVE_0386 ILMN Controls ILMN_Controls negative_0386 negative_0386 negative_0386 negative_0386 S 1 CCTGGTGTCTCTGTCGTCAGGTCCCATCCACAACCTCTTCTTACCCCGAA
ILMN_1343872 2260348 ILMN_160135 NEGATIVE_0354 1 NEGATIVE_0354 ILMN Controls ILMN_Controls negative_0354 negative_0354 negative_0354 negative_0354 S 1 GTTAGCGCGGGGGTATAGTGGGTTGGGGCGCTCTTGTGCACTGAAGCACT
ILMN_1343914 160414 ILMN_160112 NEGATIVE_0306 0 NEGATIVE_0306 ILMN Controls ILMN_Controls negative_0306 negative_0306 negative_0306 negative_0306 S 1 AGAAGCGAACGACTCGGTGCACAGTTGCGAGAGAGGTGAATTGCGGCGAG
ILMN_1343977 7570392 ILMN_160087 NEGATIVE_0228 0 NEGATIVE_0228 ILMN Controls ILMN_Controls negative_0228 negative_0228 negative_0228 negative_0228 S 1 TTCCTGAAGTGCGCCAAGGTGCCGTCACCGTATCTGATGTGTGGTCTCTG
ILMN_1344038 160278 ILMN_160055 NEGATIVE_0151 0 NEGATIVE_0151 ILMN Controls ILMN_Controls negative_0151 negative_0151 negative_0151 negative_0151 S 1 CCGCATGCAGATTGTGAGTCTGCGGCGATGTACCGGACGCTCTCGCATTG
ILMN_1344055 5490091 ILMN_159654 NEGATIVE_0070 1 NEGATIVE_0070 ILMN Controls ILMN_Controls negative_0070 negative_0070 negative_0070 negative_0070 S 1 GAAGGCGATTGTGGGGCTGAAACGGTGGTGTGATAGGCGAAAAGGGGGTG
ILMN_1344056 3360070 ILMN_159653 NEGATIVE_0069 0 NEGATIVE_0069 ILMN Controls ILMN_Controls negative_0069 negative_0069 negative_0069 negative_0069 S 1 GACGGCTCTTTGGTTAGCCGGGGATCTGGTGACTAACATCACCCTCCCTG
ILMN_1651199 1770632 ILMN_45326 LOC643334 0 LOC643334 Homo sapiens RefSeq XM_931492.1 XM_931492.1 XM_931492.1 643334 88954077 XM_931492.1 LOC643334 XP_936585.1 S 1 ATGCGAGGCCCCAGGGTTCGGCCCCGCAGCGCCGCTGAGTCCAAGGACCG 2 + 238529557-238529606 2q37.3b PREDICTED: Homo sapiens hypothetical LOC643334 (LOC643334) mRNA. XM_931492.1
ILMN_1651209 2940221 ILMN_8692 SLC35E2 1 SLC35E2 Homo sapiens RefSeq NM_182838.1 NM_182838.1 NM_182838.1 9906 33469136 NM_182838.1 SLC35E2 NP_878258.1 S 1103 TCACGGCGTACGCCCTCATGGGGAAAATCTCCCCGGTGACTTTCAGGTCC 1 - 1663958-1663962:1666129-1666173 1p36.33a Homo sapiens solute carrier family 35 member E2 (SLC35E2) mRNA. NM_182838.1

Total number of rows: 47556

Table truncated, full table size 18068 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap