NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL26511 Query DataSets for GPL26511
Status Public on Apr 17, 2019
Title Infinium Human Exome-12 v1.2 BeadChip
Technology type oligonucleotide beads
Distribution commercial
Organism Homo sapiens
Manufacturer Illumina Inc.
Manufacture protocol see manufacturer's website
 
Description Descriptor File Name: HumanExome-12v1-2_B.bpm
 
Submission date Apr 17, 2019
Last update date Apr 17, 2019
Contact name GEO admin
E-mail(s) geo@ncbi.nlm.nih.gov
Organization name NCBI/NLM/NIH
Street address 9000 Rockville Pike
City Bethesda
State/province MD
ZIP/Postal code 20892
Country USA
 
Samples (230) GSM3731268, GSM3731269, GSM3731270, GSM3731271, GSM3731272, GSM3731273 
Series (1)
GSE130068 Genomewide Association Study of Tacrolimus Pharmacokinetics Identifies Novel Single Nucleotide Polymorphisms in Convalescence Phase and Stabilizing Phase of Liver function Respectively

Data table header descriptions
ID
IlmnID
SPOT_ID IlmnID
IlmnStrand
SNP
AddressA_ID
AlleleA_ProbeSeq
AddressB_ID
AlleleB_ProbeSeq
GenomeBuild
Chr
MapInfo
Ploidy
Species
Source
SourceVersion
SourceStrand
SourceSeq
TopGenomicSeq
BeadSetID
Exp_Clusters
RefStrand

Data table
ID IlmnID SPOT_ID IlmnStrand SNP AddressA_ID AlleleA_ProbeSeq AddressB_ID AlleleB_ProbeSeq GenomeBuild Chr MapInfo Ploidy Species Source SourceVersion SourceStrand SourceSeq TopGenomicSeq BeadSetID Exp_Clusters RefStrand
exm-IND1-200449980 exm-IND1-200449980-0_M_R_1990486447 exm-IND1-200449980 MINUS [D/I] 81717304 CTGTGGAACTTTCCGGAGCTCGGCACCCTTCCCCCAAGCCTACCTGGGCG 37 1 202183358 diploid Homo sapiens 1000genomes 0 PLUS GAGGGCCGCTCAGCGAGGGCGGGACAGAACCTCTCCCGGGCTGGGAGTGCACGGCGCGGT[-/G]CGCCCAGGTAGGCTTGGGGGAAGGGTGCCGAGCTCCGGAAAGTTCCACAGGTCCTCCGCA GAGGGCCGCTCAGCGAGGGCGGGACAGAACCTCTCCCGGGCTGGGAGTGCACGGCGCGGT[-/G]CGCCCAGGTAGGCTTGGGGGAAGGGTGCCGAGCTCCGGAAAGTTCCACAGGTCCTCCGCA 850 3 -
exm-IND1-85310248 exm-IND1-85310248-0_P_F_1990486624 exm-IND1-85310248 PLUS [I/D] 41796243 TCAGAACCATGGCTCCAAAACAAAAGAAAAAGACATCACGTGGCAAAAAA 37 1 85537661 diploid Homo sapiens 1000genomes 0 PLUS CTTTATGCAGCCCAAGTCAGAACCATGGCTCCAAAACAAAAGAAAAAGACATCACGTGGC[-/A]AAAAAAGACTAAAACCAGTATTAGCTGGTAGGAATATTTCTTCATTGAATGGGATTTTTT CTTTATGCAGCCCAAGTCAGAACCATGGCTCCAAAACAAAAGAAAAAGACATCACGTGGC[-/A]AAAAAAGACTAAAACCAGTATTAGCTGGTAGGAATATTTCTTCATTGAATGGGATTTTTT 850 3 +
exm-IND10-102817747 exm-IND10-102817747-0_P_F_1990486569 exm-IND10-102817747 PLUS [I/D] 19664562 CTCTGCAAGTTTTGTGCCTTAGCGGAAAGAGGCGACATCTCTGGCAAGTT 37 10 102827757 diploid Homo sapiens 1000genomes 0 PLUS GGGAACACCTGGCTCTGCAAGTTTTGTGCCTTAGCGGAAAGAGGCGACATCTCTGGCAAG[-/T]TTGGGAGTACAGGAAGTAGCGAAGGAGTGCCATCTGGTGGATCCTTCTGGTAGTGACACT GGGAACACCTGGCTCTGCAAGTTTTGTGCCTTAGCGGAAAGAGGCGACATCTCTGGCAAG[-/T]TTGGGAGTACAGGAAGTAGCGAAGGAGTGCCATCTGGTGGATCCTTCTGGTAGTGACACT 850 3 +
exm-IND10-18329639 exm-IND10-18329639-0_M_R_1990486442 exm-IND10-18329639 MINUS [D/I] 90710943 AAGGCTGCTCCTATGGCTAGGCCATCTGCAAAATTATGCAGGCTGTCCCC 37 10 18289633 diploid Homo sapiens 1000genomes 0 PLUS CTGTGTTTATTTGGTTCCTTAGGTAAAGCCATTAGCTTGTTAGCAATCATGATTCTGGTT[-/G]GGGGACAGCCTGCATAATTTTGCAGATGGCCTAGCCATAGGAGCAGCCTTCTCATCATCA CTGTGTTTATTTGGTTCCTTAGGTAAAGCCATTAGCTTGTTAGCAATCATGATTCTGGTT[-/G]GGGGACAGCCTGCATAATTTTGCAGATGGCCTAGCCATAGGAGCAGCCTTCTCATCATCA 850 3 -
exm-IND10-27476467 exm-IND10-27476467-0_M_R_1990486443 exm-IND10-27476467 MINUS [D/I] 84671948 ATGGAGCCAGCAAAAAGGATGAAGAAGAGCTTGGACACAACCGATAACTG 37 10 27436462 diploid Homo sapiens 1000genomes 0 PLUS GCATTTGGAGAAACCCGCAGTGTACAGGGATTGAGAGGGAGAAGGGTTCTGGACGGAtgT[-/GC]cagttatcggttgtgtccaagctcttcttcatcctttttgctggctccatgaacatggat GCATTTGGAGAAACCCGCAGTGTACAGGGATTGAGAGGGAGAAGGGTTCTGGACGGAtgT[-/GC]cagttatcggttgtgtccaagctcttcttcatcctttttgctggctccatgaacatggat 850 3 -
exm-IND10-27727540 exm-IND10-27727540-0_M_R_1990486444 exm-IND10-27727540 MINUS [I/D] 98635146 ATTATTTTTCAGATTATGGTCCCAGGGTTATGGTTATTGTTACTAAAAAA 37 10 27687534 diploid Homo sapiens 1000genomes 0 PLUS TTCAAAAATTTTAGTACAGTTTTCCAGTTTTTGCCTAACATCTTTATCCCAGTAGTCAAC[-/T]TTTTTTAGTAACAATAACCATAACCCTGGGACCATAATCTGAAAAATAATTCTCCTCTAC TTCAAAAATTTTAGTACAGTTTTCCAGTTTTTGCCTAACATCTTTATCCCAGTAGTCAAC[-/T]TTTTTTAGTAACAATAACCATAACCCTGGGACCATAATCTGAAAAATAATTCTCCTCTAC 850 3 -
exm-IND10-74560589 exm-IND10-74560589-0_P_F_1990486573 exm-IND10-74560589 PLUS [D/I] 14612885 GGCCCCTATACTCAGCAACAGAATGGGACTTTCCCATTCTGGCTGCCCCC 37 10 74890583 diploid Homo sapiens 1000genomes 0 PLUS GCCCTGAAGAGAAAGGGCCCCTATACTCAGCAACAGAATGGGACTTTCCCATTCTGGCTG[-/C]CCCCCTAAGTTAGCCATCTCCCACCAACTGATTAAGGAGTGGGTGGAAAAACAGACCTGT GCCCTGAAGAGAAAGGGCCCCTATACTCAGCAACAGAATGGGACTTTCCCATTCTGGCTG[-/C]CCCCCTAAGTTAGCCATCTCCCACCAACTGATTAAGGAGTGGGTGGAAAAACAGACCTGT 850 3 +
exm-IND11-102094357 exm-IND11-102094357-0_P_F_1990486575 exm-IND11-102094357 PLUS [D/I] 64785940 CCCAGGTCCTACCATGTACTATGACTCTCTTGAGAAGACCTTACCATAGA 37 11 102589147 diploid Homo sapiens 1000genomes 0 PLUS GTGTTCGCCTATTCCCAGGTCCTACCATGTACTATGACTCTCTTGAGAAGACCTTACCAT[-/AG]AGATGGCCTGAATGCCATCGATGTCATCTTGAGGGAGTGAGTAGTTGCTGGTTTCCCTGA GTGTTCGCCTATTCCCAGGTCCTACCATGTACTATGACTCTCTTGAGAAGACCTTACCAT[-/AG]AGATGGCCTGAATGCCATCGATGTCATCTTGAGGGAGTGAGTAGTTGCTGGTTTCCCTGA 850 3 +
exm-IND11-60867390 exm-IND11-60867390-0_M_R_1990486445 exm-IND11-60867390 MINUS [D/I] 52774108 GCTGACATGAAGGTGCCCACCAGGGCACGGGCAATCTTCACCCCGCGGCC 37 11 61110815 diploid Homo sapiens 1000genomes 0 PLUS TGTTTTCTTTCCCTGATGCCCATTTTTCCCTTTTGGACTGCCACACTCTGGTATTGCAGA[-/G]GGCCGCGGGGTGAAGATTGCCCGTGCCCTGGTGGGCACCTTCATGTCAGCACTGGAGATG TGTTTTCTTTCCCTGATGCCCATTTTTCCCTTTTGGACTGCCACACTCTGGTATTGCAGA[-/G]GGCCGCGGGGTGAAGATTGCCCGTGCCCTGGTGGGCACCTTCATGTCAGCACTGGAGATG 850 3 -
exm-IND11-73463127 exm-IND11-73463127-0_P_F_1990486580 exm-IND11-73463127 PLUS [I/D] 37663978 GAGACTTCTGGTGGCAGGAGATGACTTCTGGTGGAGAGAGCTGGACCTCA 37 11 73785480 diploid Homo sapiens 1000genomes 0 PLUS GTGGAGGCAGGAGACTTCTGGTGGCAGGAGATGACTTCTGGTGGAGAGAGCTGGACCTCA[-/T]CATTCCTTCTGGGGAGCTGCTCAGACTCACTGTGGCTGCTGCAGTCCATGGAGTCCAGCT GTGGAGGCAGGAGACTTCTGGTGGCAGGAGATGACTTCTGGTGGAGAGAGCTGGACCTCA[-/T]CATTCCTTCTGGGGAGCTGCTCAGACTCACTGTGGCTGCTGCAGTCCATGGAGTCCAGCT 850 3 +
exm-IND12-4584372 exm-IND12-4584372-0_P_F_1990486581 exm-IND12-4584372 PLUS [I/D] 26678951 CTTACTTTGCCTCCGCAGTATACACGTACATCCAAAGCCGGTTCTACCGA 37 12 4714112 diploid Homo sapiens 1000genomes 0 PLUS CGAGGTTTCTCTTACTTTGCCTCCGCAGTATACACGTACATCCAAAGCCGGTTCTACCGA[-/T]CCCCAGAAGTGATCCTGGGCCACCCCTACGACGTGGCCATTGACATGTGGAGCCTGGGCT CGAGGTTTCTCTTACTTTGCCTCCGCAGTATACACGTACATCCAAAGCCGGTTCTACCGA[-/T]CCCCAGAAGTGATCCTGGGCCACCCCTACGACGTGGCCATTGACATGTGGAGCCTGGGCT 850 3 +
exm-IND12-46829523 exm-IND12-46829523-0_M_R_1990486450 exm-IND12-46829523 MINUS [I/D] 71660230 CTATGTGAAAAACTGACTGTTCTGTGCTCAGCTCCAGGAACTCTAAAAAC 37 12 48543257 diploid Homo sapiens 1000genomes 0 PLUS GCCCTTCACTGCATCGGGGAGATACTGGAGTCCCAGGCTACGGCGCACGGCATAGCGAGC[-/GAGT]GTTTTTAGAGTTCCTGGAGCTGAGCACAGAACAGTCAGTTTTTCACATAGCTGCGGGTCT GCCCTTCACTGCATCGGGGAGATACTGGAGTCCCAGGCTACGGCGCACGGCATAGCGAGC[-/GAGT]GTTTTTAGAGTTCCTGGAGCTGAGCACAGAACAGTCAGTTTTTCACATAGCTGCGGGTCT 850 3 -
exm-IND12-49036005 exm-IND12-49036005-0_P_F_1990486582 exm-IND12-49036005 PLUS [I/D] 33668228 AGATCTCGTATTATCTTCAGAGAGAGCTCCTTTTCTGCTTCACTTGTCTC 37 12 50749739 diploid Homo sapiens 1000genomes 0 PLUS TTCGTTACTGAGATCTCGTATTATCTTCAGAGAGAGCTCCTTTTCTGCTTCACTTGTCTC[-/AT]GTGCATACACAGTGGAACTTTGGAAGTTAACACATTTTAATTCATCATTTAGCATACTCA TTCGTTACTGAGATCTCGTATTATCTTCAGAGAGAGCTCCTTTTCTGCTTCACTTGTCTC[-/AT]GTGCATACACAGTGGAACTTTGGAAGTTAACACATTTTAATTCATCATTTAGCATACTCA 850 3 +
exm-IND12-51232970 exm-IND12-51232970-0_P_F_1990486584 exm-IND12-51232970 PLUS [D/I] 5749299 CCTCCACTCTTCCCGCTGCCACTGGCCACATTGAGGCTCCGGACACCCCC 37 12 52946704 diploid Homo sapiens 1000genomes 0 PLUS CGGCCAAATCCATAGCCTCCACTCTTCCCGCTGCCACTGGCCACATTGAGGCTCCGGACA[-/C]CCCCCAGGCTGTAGAGGCTCCGGCTGCCAAAGCCCCCACTGAGCCCTTTGCTCCCTGCCC CGGCCAAATCCATAGCCTCCACTCTTCCCGCTGCCACTGGCCACATTGAGGCTCCGGACA[-/C]CCCCCAGGCTGTAGAGGCTCCGGCTGCCAAAGCCCCCACTGAGCCCTTTGCTCCCTGCCC 850 3 +
exm-IND12-54361914 exm-IND12-54361914-0_M_R_1990486452 exm-IND12-54361914 MINUS [I/D] 96699110 TCTTGCTCTCCATCTTGCGGTTGCTCTTGGGAGTCAGCACGGCCATCAGG 37 12 56075648 diploid Homo sapiens 1000genomes 0 PLUS TGCCCCTGCACCTCATGGCTCTGCTGGGCTGCTGGCAGCCCCTGTGCAAAAGCTACTTCC[-/CCTA]CCTGATGGCCGTGCTGACTCCCAAGAGCAACCGCAAGATGGAGAGCAAGAAACGGGAGCT TGCCCCTGCACCTCATGGCTCTGCTGGGCTGCTGGCAGCCCCTGTGCAAAAGCTACTTCC[-/CCTA]CCTGATGGCCGTGCTGACTCCCAAGAGCAACCGCAAGATGGAGAGCAAGAAACGGGAGCT 850 3 -
exm-IND12-67380833 exm-IND12-67380833-0_P_F_1990486586 exm-IND12-67380833 PLUS [D/I] 40670112 AGTAAAATAGTGAGTCGAGCAACACCTGGACTTCAAAAATTTTCAAAAAC 37 12 69094566 diploid Homo sapiens 1000genomes 0 PLUS TGAATATACTGAGTAAAATAGTGAGTCGAGCAACACCTGGACTTCAAAAATTTTCAAAAA[-/C]CAGCCAGTATGCTCTGGCTTCTTCAACAGGAGATGGTCACATGGAGGCTGCTGGCTTCTT TGAATATACTGAGTAAAATAGTGAGTCGAGCAACACCTGGACTTCAAAAATTTTCAAAAA[-/C]CAGCCAGTATGCTCTGGCTTCTTCAACAGGAGATGGTCACATGGAGGCTGCTGGCTTCTT 850 3 +
exm-IND12-83947680 exm-IND12-83947680-0_M_R_1990486453 exm-IND12-83947680 MINUS [I/D] 46668200 AAAAAAATAAGCATTGACTTTCTTTTTTTAGGTTCTTGGACTTTTATTCA 37 12 85423550 diploid Homo sapiens 1000genomes 0 PLUS TACATACCAAAAGCTGTTAAAAAATTATTTCTATCTAATAAGAGCCATGCACCAAATCCC[-/A]TGAATAAAAGTCCAAGAACCTAAAAAAAGAAAGTCAATGCTTATTTTTTTGTAATTGCCT TACATACCAAAAGCTGTTAAAAAATTATTTCTATCTAATAAGAGCCATGCACCAAATCCC[-/A]TGAATAAAAGTCCAAGAACCTAAAAAAAGAAAGTCAATGCTTATTTTTTTGTAATTGCCT 850 3 -
exm-IND12-8887191 exm-IND12-8887191-0_M_R_1990486455 exm-IND12-8887191 MINUS [D/I] 77692474 CCCCGTTTCCCGGTCTCACATAGTAGGAGAAGCTGATCTCTTGGTCAGGG 37 12 8995925 diploid Homo sapiens 1000genomes 0 PLUS TTGAAATGTGGCCAGCCCCAGGAAGTGCTGGTGGATTATTACATCGACCCGGCCGATGCA[-/AG]CCCTGACCAAGAGATCAGCTTCTCCTACTATGTGAGACCGGGAAACGGGGACGGGTGAGA TTGAAATGTGGCCAGCCCCAGGAAGTGCTGGTGGATTATTACATCGACCCGGCCGATGCA[-/AG]CCCTGACCAAGAGATCAGCTTCTCCTACTATGTGAGACCGGGAAACGGGGACGGGTGAGA 850 3 -
exm-IND13-47565698 exm-IND13-47565698-0_P_F_1990486590 exm-IND13-47565698 PLUS [I/D] 43699591 AACTTCACAGATCACAGAATCAGTACACATAACTACCTCTGAGTGAACAC 37 13 48667698 diploid Homo sapiens 1000genomes 0 PLUS GAGACTGACAAACTTCACAGATCACAGAATCAGTACACATAACTACCTCTGAGTGAACAC[-/AT]GAGACCTTTCTGGAAGCCAGTCACACCACCAGAGCAGCTTCATTCTGTGAAGAAGTTCCA GAGACTGACAAACTTCACAGATCACAGAATCAGTACACATAACTACCTCTGAGTGAACAC[-/AT]GAGACCTTTCTGGAAGCCAGTCACACCACCAGAGCAGCTTCATTCTGTGAAGAAGTTCCA 850 3 +
exm-IND13-72445734 exm-IND13-72445734-0_P_F_1990486592 exm-IND13-72445734 PLUS [I/D] 87739392 CTAACATAATGACTTTTTAAAACTGGGGTTTTTTTTTTCAGCAACTTAAA 37 13 73547734 diploid Homo sapiens 1000genomes 0 PLUS TAACTATATTTATACTAACATAATGACTTTTTAAAACTGGGGTTTTTTTTTTCAGCAACT[-/TAAA]TAAAGAAAAGTCAGCTTTACTACAGACGAAGAATCAAATGGCATTAGATTTAGAACAACT TAACTATATTTATACTAACATAATGACTTTTTAAAACTGGGGTTTTTTTTTTCAGCAACT[-/TAAA]TAAAGAAAAGTCAGCTTTACTACAGACGAAGAATCAAATGGCATTAGATTTAGAACAACT 850 3 +

Total number of rows: 244770

Table truncated, full table size 104979 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap