NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL20 Query DataSets for GPL20
Status Public on Nov 14, 2001
Title Incyte Drosophila LifeArray v1.0
Technology type spotted DNA/cDNA
Distribution non-commercial
Organism Drosophila melanogaster
 
Description The array was assembled using amplicons representing approximately 93% of the genes predicted in version 1.0 of the Drosophila genome from sequences released by the Berkeley Drosophila Genome Project and Celera Genomics in March 2000. The amplicons represent approximately 75% of the genes predicted in the January 2003 release 3.1 Drosophila genome annotation update.

Incyte in-house algorithms were used to develop gene-specific primers averaging 20 nucleotides in length that were used to PCR amplify one exon or exon fragment from every predicted gene in the fly genome. The regions amplified to build the array ranged in size from 150 to 600 bp with an average size of 410 bp. PCR fragments were amplified and each amplicon was quality control tested for DNA concentration, purity, and fragment size. A total of 13,856 unique Drosophila elements are included on the array. Each element was spotted in duplicate(some are spotted multiple times) for a total of 29,222 elements which were distributed on two separate glass slides designated subarrays A and B. In addition to the Drosophila elements, both halves of the array contain non-Drosophila controls elements that serve to orient the arrays, function to correct for background and to provide calibration standards. The total number of elements (Drosophila transcripts and controls) is 31,464. Each array element includes an area of 150 micron diameter with a center to center separation of 170 microns. Adhesion to glass was facilitated by UV crosslinking at 120,000 mj/cm2.
Qualification of the arrays was examined by dying representatives of each print run with Syto 61 dye. Dyed slides were read with a GenePix 4000A scanner (Axon Instruments, Foster City, CA) at 535 nm.
The April 2007 platform update is based on the Dmel_RELEASE 4.1 re-annotation result from DGRC (https://dgrc.cgb.indiana.edu/microarrays/annotation.html).
 
Contributor(s) Oliver B, Edwards P
Submission date Oct 03, 2001
Last update date Jan 18, 2013
Contact name Brian Oliver
E-mail(s) briano@helix.nih.gov
Phone 301-496-5495
Organization name NIDDK, NIH
Department LCDB
Lab Developmental Genomics
Street address 50 South Drive
City Bethesda
State/province MD
ZIP/Postal code 20892
Country USA
 
Samples (213) GSM2456, GSM2457, GSM2458, GSM2459, GSM2460, GSM2461 
Series (8)
GSE442 Sex-biased gene expression
GSE757 Drosophila melanogaster strain comparison
GSE2119 Global analysis of X chromosome dosage compensation

Data table header descriptions
ID
FLYBASE Flybase ID assigned by DGRC remapping
FLYBASE_SECONDARY Secondary Flybase ID assigned by DGRC remapping
RELEASE D.mel annotation version of DGRC remapping
GENE_NAME Dmel_RELEASE 4.1 Gene name assigned by DGRC remapping
GENE_SYMBOL Dmel_RELEASE 4.1 Gene symbol assigned by DGRC remapping
GENE_SYNONYMS Dmel_RELEASE 4.1 Gene synonyms assigned by DGRC remapping
DGRC.PROBE_ID Probe ID assigned by DGRC
CHROMOSOME Dmel_RELEASE 4.1 Chromsome location
TRANSCRIPTS Dmel_RELEASE 4.1 Transcript assigned by DGRC remapping
START_COORD Dmel_RELEASE 4.1 Start coordinate of predicted amplicon
STOP_COORD Dmel_RELEASE 4.1 Stop coordinate of amplicon
LENGTH Amplicon length
CYTO Dmel_RELEASE 4.1 Cytological location
GO_MOL_FUNC GO assignment, Molecular Function
GO_BIO_PROC GO assignment, Biological Process
GO_CELL_COMP GO assignment, Cellular Component
R3.1_GENE_NAME Gene name in Dmel_RELEASE 3.1 mapping
R1_GENE_NAME Gene name in Dmel_RELEASE 1 mapping
SUBARRAY Each array includes elements split into two chips designated A or B
LOCATION Location of element on the subarray
PLATEID Plate ID for amplicon source used for array elements
PLATEROW Row location of amplicons on plate
PLATECOLUMN Column location of amplicons on plate
INCYTECLONEID Incyte clone ID number used for array
CLONESOURCE Source of clone
PRIMERS Sequence of primers used for PCR amplification
STATUS 1 - PCR status, PCR products flagged by Incyte quality control that showed failed amplification, multiple bands, wrong size bands or primer problems, 2 - predicted amplicon not from dmelr3 or mitochondrial genome sequence, but heterochromatin scaffolds, 3 - multiple amplicons predicted, 4 - multiple BLAST hits for amplicon(s), 5 - amplicon(s) map to multiple genome features, 6 - FLAGGED_PROBLEMATIC by Flybase in D.mel annotations
CLONE_ID Flybase ID assigned by DGRC remapping
SPOT_ID identifies spots without FBgn number in CLONE_ID

Data table
ID FLYBASE FLYBASE_SECONDARY RELEASE GENE_NAME GENE_SYMBOL GENE_SYNONYMS DGRC.PROBE_ID CHROMOSOME TRANSCRIPTS START_COORD STOP_COORD LENGTH CYTO GO_MOL_FUNC GO_BIO_PROC GO_CELL_COMP R3.1_GENE_NAME R1_GENE_NAME SUBARRAY LOCATION PLATEID PLATEROW PLATECOLUMN INCYTECLONEID CLONESOURCE PRIMERS STATUS CLONE_ID SPOT_ID
1 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA 18s-rRNA A 5 B11I0162 A 8 NA Controls NA ok -- control
2 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NC_001133_4 A 6 B11B0161 H 4 NA Controls NA ok -- control
3 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA Frag_85 A 7 B11B0161 G 4 NA Controls NA ok -- control
4 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA Frag-54 A 8 B11B0161 F 4 NA Controls NA ok -- control
5 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NC_001141_5 A 9 B11B0161 E 4 NA Controls NA ok -- control
6 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NC_001224_3 A 10 B11B0161 D 4 NA Controls NA ok -- control
7 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NC_001144_1 A 11 B11B0161 C 4 NA Controls NA ok -- control
8 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NC_001141_2 A 12 B11B0161 B 4 NA Controls NA ok -- control
9 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NC_001140_1 A 13 B11B0161 A 4 NA Controls NA ok -- control
10 FBgn0030261 4.1 CG15203 CG15203 INC004D02 X CG15203-RA 10911850 10912139 289 10A4 CG15203 CG15203 A 14 B1130084 D 2 821941641 Incyte Custom AGTCCAAATCCATTGATACCAT AGTATTGATCCATCCTTGTTGC ok FBgn0030261
11 FBgn0052485 FBgn0035391 4.1 CG32485 CG32485 CG2159, CG2159 INC004C02 3L CG32485-RA 3034538 3034964 426 63A5 CG32485 CG2159 A 15 B1130084 C 2 821936770 Incyte Custom CATTCTAAAGACCAACAAGTGG GTATTGTCGTCCAACAGTACAC ok FBgn0052485
12 FBgn0028982 FBgn0026691, FBgn0028682 4.1 CG12225 Spt6 CG12225, CG12225, l(1)G0063, Dspt6, SPT6, spt 6, dSpt6, spt6 INC004B02 X CG12225-RA 6118074 6118573 499 5E4 RNA elongation ; GO:0006354, RNA elongation from Pol II promoter ; GO:0006368, chromatin assembly or disassembly ; GO:0006333, intracellular signaling cascade ; GO:0007242, transcription initiation from Pol II promoter ; GO:0006367 RNA binding ; GO:0003723, chromatin binding ; GO:0003682, chromatin binding ; GO:0003682 , chromatin binding ; GO:0003682 , transcriptional elongation regulator activity ; GO:0003711 , RNA binding ; GO:0003723 , hydrolase activity, acting on ester bonds ; GO:0016788 ; EC:3.1.-.- , general RNA polymerase II transcription factor activity ; GO:0016251 , hydrolase activity, acting on ester bonds ; GO:0016788 ; EC:3.1.-.-, general RNA polymerase II transcription factor activity ; GO:0016251, transcriptional elongation regulator activity ; GO:0003711 CG12225 spt6 A 16 B1130084 B 2 821931768 Incyte Custom ACTATGATTATGTGACTGAGGAGC AAGTAGTGTATCTTCTTCGGATCA ok FBgn0028982
13 FBgn0023000 4.1 CG6936 mth CG6936, CG6936, Mth, MTH, methuselah INC004A02 3L CG6936-RA,CG6936-RB 328909 329395 486 61C1 G-protein coupled receptor protein signaling pathway ; GO:0007186, aging ; GO:0007568, determination of adult life span ; GO:0008340, response to heat ; GO:0009408, response to oxidative stress ; GO:0006979, response to starvation ; GO:0042594, response to stress ; GO:0006950, synaptic vesicle exocytosis ; GO:0016079 G-protein coupled receptor activity ; GO:0004930 , G-protein coupled receptor activity ; GO:0004930 , G-protein coupled receptor activity ; GO:0004930 CG6936 mth A 17 B1130084 A 2 821934873 Incyte Custom CTTCGGATATCAACTGTCATACTT GAACAACGTGTACTTATCCTGTTC 5 FBgn0023000
14 FBgn0045759 FBgn0015501, FBgn0035728 4.1 CG18647 bin CG18647, CG18647, XIV, Biniou, FoxF, Dmbin, l(3)65CEe, Distal W5.4 Group XIV INC004H01 3L CG18647-RA,CG18647-RB 6965322 6965735 413 65D6 mesoderm cell fate commitment ; GO:0001710, phosphoenolpyruvate-dependent sugar phosphotransferase system ; GO:0009401, regulation of transcription ; GO:0045449, regulation of transcription from Pol II promoter ; GO:0006357 transcription factor activity ; GO:0003700, sugar porter activity ; GO:0005351, transcription factor activity ; GO:0003700 , sugar porter activity ; GO:0005351 CG18647 CG18647 A 18 B1130084 H 1 821944159 Incyte Custom CATTAAGTACTGCTCCAACAACA TCATATTGATATAGCTGAGTGCTG ok FBgn0045759
15 FBgn0038508 4.1 CG5866 CG5866 INC004G01 3R CG5866-RA 13241653 13242088 435 90A6 CG5866 CG5866 A 19 B1130084 G 1 821933802 Incyte Custom CATCAACGAGTACATCTGTATCAA TTATAACCAACCTGGCTTAAGTTC ok FBgn0038508
16 FBgn0034551 4.1 CG15225 CG15225 INC004F01 2R CG15225-RA 16300660 16301258 598 57B2 CG15225 CG15225 A 20 B1130084 F 1 821941670 Incyte Custom AGGAGAATCTTGAGCAGAACTC ATGAGTCCAATACCGAAGAACT ok FBgn0034551
17 FBgn0035606 4.1 CG15214 CG15214 CT35147 INC004E01 3L CG15214-RA 5413136 5413385 249 64D1 CG15214 CG15214 A 21 B1130084 E 1 821941655 Incyte Custom ACAATATCATACCCTCATCACG GTTCTGTGTAGAACGTGCTCTT 1 FBgn0035606
18 FBgn0036426 4.1 CG9592 CG9592 INC004D01 3L CG9592-RA 14483125 14483584 459 70E1 CG9592 CG9592 A 22 B1130084 D 1 821936989 Incyte Custom AAATATCCTGTTAAGAGATGAGCC CAACTACCAGATCCAGACAGTTAT ok FBgn0036426
19 FBgn0014073 4.1 CG7525 Tie CG7525, CG7525, DPR1, tie, RTK, tyrosine kinase INC004C01 3L CG7525-RA 4491737 4492232 495 64B9 JAK-STAT cascade ; GO:0007259, protein amino acid phosphorylation ; GO:0006468 ATP binding ; GO:0005524, ATP binding ; GO:0005524 , protein-tyrosine kinase activity ; GO:0004713 ; EC:2.7.1.112 , protein-tyrosine kinase activity ; GO:0004713 ; EC:2.7.1.112 , non-membrane spanning protein tyrosine kinase activity ; GO:0004715 ; EC:2.7.1.- , protein-tyrosine kinase activity ; GO:0004713 ; EC:2.7.1.112, non-membrane spanning protein tyrosine kinase activity ; GO:0004715 ; EC:2.7.1.-, protein-tyrosine kinase activity ; GO:0004713 ; EC:2.7.1.112 CG7525 Tie A 23 B1130084 C 1 821934030 Incyte Custom AGACTAGAGATCACAAGGTCACTG ACTCGAAGATGGGATTTTAGATAC ok FBgn0014073
20 FBgn0035522 4.1 CG1273 CG1273 INC004B01 3L CG1273-RB 4259024 4259616 592 64A12 CG1273 CG1273 A 24 B1130084 B 1 821936686 Incyte Custom ACTCCTACAGTGAACCATATACCA TTTCCACTTTAGTGGTTATCTCTG ok FBgn0035522

Total number of rows: 31464

Table truncated, full table size 13834 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap