NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL16484 Query DataSets for GPL16484
Status Public on Jan 10, 2013
Title Plasmodium falciparum Custom 244k Array designed by Genotypic Technology Pvt. Ltd. & Prof.Ashis K Das (AMADID:019056)
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Plasmodium falciparum 3D7
Manufacturer Agilent Technologies
Manufacture protocol www.chem.agilent.com
 
 
Contributor(s) Ashis DK, Raja MC
Submission date Jan 09, 2013
Last update date Mar 05, 2013
Contact name Genotypic technology
E-mail(s) sudha.rao@genotypic.co.in
Organization name Genotypic Technology
Street address 259, Apoorva 4th cross,80 feet Road,RMV 2ND STAGE
City Bangalore
State/province Karnataka
ZIP/Postal code 560094
Country India
 
Samples (2) GSM1093935, GSM1093936
Series (1)
GSE44921 Natural anitsense transcripts in Plasmodium falciparum clinical isolates

Data table header descriptions
ID
GB_ACC GenBank Accession number
ORF ORF Name
NAME
GENE DESCRIPTION Gene Description
SEQUENCE oligonucleotide Probe sequence
SPOT_ID

Data table
ID GB_ACC ORF NAME GENE DESCRIPTION SEQUENCE SPOT_ID
GT_NF_000001 BQ576980 BQ576980 BQ576980 PfESToab12c05.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum 3D7 cDNA 5' similar to TR:Q9U762 Q9U762 RIBOSOMAL PROTEIN S6. ;, mRNA sequence GTTGGTCAAGATTTATCAGCATTAAATTTAACATTAGTTAAAAAAGGTGTAAATGAAATA
GT_NF_000002 EL505056 EL505056 EL505056 F01_2326_1.AB1 Blood stage Plasmodium falciparum cDNA library PFExtensions Plasmodium falciparum 3D7 cDNA, mRNA sequence CTACTTAAAAAATATAATAAAAATGTTGAAAGACATTTCATAAGTGCTAGAAATACAACC
GT_NF_000003 BQ451501 BQ451501 BQ451501 PfESToab01b10.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum 3D7 cDNA 5' similar to TR:O04269 O04269 PHOSPHATIDYLINOSITOL 3-KINASE ;, mRNA sequence TTATCATGCGACGACATAAGAGTATAATGCGGCGACATAAGTTTATCATGCGATGGCATC
GT_NF_000004 EL502677 EL502677 EL502677 D06_PFLAB1-M-PLATE1B.AB1 Blood stage Plasmodium falciparum cDNA library PfSuOrig Plasmodium falciparum 3D7 cDNA, mRNA sequence TAAGAGGGATATCAAGGATGAAATATTTTATGAGAATATAGGTGAATTTATAAATGATGA
GT_NF_000005 BU496070 BU496070 BU496070 PfESToac03d10.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum 3D7 cDNA 5', mRNA sequence AAACTATATTTAGAAAATAATCATATTGAATCTACGCATAACTTTTTATCAAAAAATATC
GT_NF_000006 BQ596694 BQ596694 BQ596694 PfESToab21c07.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum 3D7 cDNA 5' similar to TR:O96387 O96387 INOSINE-5'-MONOPHOSPHATE DEHYDROGENASE. ;, mRNA sequence TTAGTTGATGAAAGGAAAAATGAATATACAGATGAAAATATTGATGAAATAAAAGTCTCT
GT_NF_000007 DK890168 DK890168 DK890168 DK890168 XPF Sugano cDNA library Plasmodium falciparum 3D7 cDNA clone XPFm0658 5', mRNA sequence GAAAACTACAAAAAGTTTTATGAACAATTCAGCAAAAACTTAAAGTTGGGTATCCACGAG
GT_NF_000008 DK893502 DK893502 DK893502 DK893502 XPF Sugano cDNA library Plasmodium falciparum 3D7 cDNA clone XPF2n3847 5', mRNA sequence TATTGAAATGGATTATATCGAGCCAGAAAATGGCACAAATAGCATGATGAATAATTTTGT
GT_NF_000009 EL502921 EL502921 EL502921 E07_PFLAB1-M-PLATE8B.AB1 Blood stage Plasmodium falciparum cDNA library PfSuOrig Plasmodium falciparum 3D7 cDNA, mRNA sequence TATGAATATCTACCTTATCATTTTTCTCATTTATATTACTTTTTTGGTTATAATTGTTTT
GT_NF_000010 BQ451904 BQ451904 BQ451904 PfESToaa89c03.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum 3D7 cDNA 5', mRNA sequence TAAACATGTAAAATTAGACTACTCTAAATTTATTATAGTATGAATAAAATTTTTTGATCT
GT_NF_000011 CA855505 CA855505 CA855505 PfESToac49e11.y1 Plasmodium falciparum 3D7 gametocyte cDNA library Plasmodium falciparum 3D7 cDNA 5' similar to TR:Q9XMS2 Q9XMS2 ORF1386. ;, mRNA sequence ATATATATTTGGTCATTCATATTCTTATGTGAAGTATGCAAAATATTTTTATCAGAAGAA
GT_NF_000012 EL499923 EL499923 EL499923 002_PFLAB1-M-P25B.AB1 Blood stage Plasmodium falciparum cDNA library PfSuOrig Plasmodium falciparum 3D7 cDNA, mRNA sequence GCTGATGCCCATCATGCACATCATGTAGCTGATGCCCATCATGCACATCATGCTCACCAT
GT_NF_000013 EL503940 EL503940 EL503940 A12_3164_35.AB1 Blood stage Plasmodium falciparum cDNA library PFExtensions Plasmodium falciparum 3D7 cDNA, mRNA sequence AATAATATACCTTGATGTAATGTATATGTATTTATAATAGCTAAAATTAGATGTTACTAC
GT_NF_000014 BQ452347 BQ452347 BQ452347 PfESToaa95e03.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum 3D7 cDNA 5' similar to SW:KC2A_THEPA P28547 CASEIN KINASE II, ALPHA CHAIN ;, mRNA sequence TTGGATTATTGTCATAGCCAAGGTATTATGCATAGAGATGTTAAACCACATAATATTATG
GT_NF_000015 BI815614 BI815614 BI815614 PfESToaa30f10.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum 3D7 cDNA 5' similar to TR:O96187 O96187 HYPOTHETICAL 163.3 KD PROTEIN. ;, mRNA sequence ATAAACAACATAAATAATATACAATTTGATAAAAGCCTATTAATTAACTGTATAGATGTC
GT_NF_000016 EL502474 EL502474 EL502474 C07_PFLAB1-L-PLATE14B.AB1 Blood stage Plasmodium falciparum cDNA library PfSuOrig Plasmodium falciparum 3D7 cDNA, mRNA sequence TAGTATTTCATAGATATATTCTACAAAATACTAGGAATAAAATTAAACAAATTCAATGTA
GT_NF_000017 EL505555 EL505555 EL505555 G11_2600_302.AB1 Blood stage Plasmodium falciparum cDNA library PFExtensions Plasmodium falciparum 3D7 cDNA, mRNA sequence TAATTTAAATATGCCAACTTTTGAAAAGTTTATAAATAAATATCATATCCTTAGGACATG
GT_NF_000018 BM275790 BM275790 BM275790 PfESToaa85g05.y1 Plasmodium falciparum 3D7 gametocyte cDNA library Plasmodium falciparum 3D7 cDNA 5', mRNA sequence AGAACCTGATAAAGAACCTGATAATGATATTTATAATGTGCTAGATAAAGTTTGTGAAAA
GT_NF_000019 BU496236 BU496236 BU496236 PfESToac05e09.y1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum 3D7 cDNA 5', mRNA sequence TATATTATCTATCCTTTGAAAACCGCATCAAATTAACACATATTCTTTTACTTACAAAAG
GT_NF_000020 EL503812 EL503812 EL503812 A07_2190_103.AB1 Blood stage Plasmodium falciparum cDNA library PFExtensions Plasmodium falciparum 3D7 cDNA, mRNA sequence GTTAATGTTTTATCATAATATCCCTTTCCGCTTCCAATTCTATAACCCAATTTATTATAT

Total number of rows: 241399

Table truncated, full table size 49645 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap