NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL15768 Query DataSets for GPL15768
Status Public on Jul 06, 2012
Title NimbleGen P. falciparum 72K array [100712_Pfal_3D7_JM_exp_72K]
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Plasmodium falciparum 3D7
Manufacturer NimbleGen
Manufacture protocol High-density DNA array prepared with Maskless Array Synthesizer (MAS) technology. See manufacturer's website at http://www.nimblegen.com/.
 
Description NimbleGen design name 100712_Pfal_3D7_exp, NimbleGen design ID 05327954001. A 35809 45-60mer probes were selected with two replicates on final array for a total of 71618 probes. For transcripts between 1-299bp, 3 probes were selected per transcript. For transcripts between 300-3999bp, 6 probes were selected per transcript. For transcripts >4000bp, 11 probes were selected per transcript. No 3' bias was used during probe selection. Tm weighting parameter (500) was used when selecting the final probes (Tm distribution between 60.90 and 77.80). It was design for 5367 genes from Plasmodium falciparum 3D7.
The probes were designed based on the NCBI genomic sequence (July 2010), and these genomic sequence accession numbers are NC_004314 -004318, NC_004325-004331, NC_002375, NC_000910, NC_000521, X95276.
The Platform data table reflects a condensed representation of the expression array's replicate (SEQ_ID) features. The .ndf and .ngd files are linked below as supplementary files.

native array description file: 100712_Pfal_3D7_JM_exp.ndf
native array description file: 100712_Pfal_3D7_JM_exp.ngd

DesignID: 539063
 
Submission date Jul 05, 2012
Last update date Jul 06, 2012
Contact name JUN MIAO
E-mail(s) jmiao1@usf.edu
Phone 8139747374
Organization name University of South Florida
Department Internal Medicine
Lab Jun Miao and Liwang Cui
Street address 3720 Spectrum Boulevard, MDC84
City Tampa
State/province Florida
ZIP/Postal code 33612
Country USA
 
Samples (12) GSM956445, GSM956446, GSM956447, GSM956448, GSM956449, GSM956450 
Series (1)
GSE39124 Expression analysis of Plasmodium falciparum 3D7 delta-PfPuf2 mutant

Data table header descriptions
ID Entrez SEQ ID number of the ORF to which the indicated probe is directed.
ORF Entrez Gene Name for the ORF to which the indicated probe is directed.
GENOME_ACC GenBank accession number of the Plasmodium falciparum 3D7 from National Center for Biotechnology Information genomic sequence (July 2010).
Entrez_Gene_ID Entrez Gene ID number for the ORF to which the indicated probe is directed.
SEQUENCE probe sequence

Data table
ID ORF GENOME_ACC Entrez_Gene_ID SEQUENCE
MAL13P1.106100500001737 MAL13P1.106 NC_004331 813654 CTTGACCACACAAGTAACCTGCGATGATAATTACCTTGACGATGATAATAGATATAACCC
MAL13P1.114100500001750 MAL13P1.114 NC_004331 813662 CATAATATTACCATGAATAAGAAGCGTGAAAGGGTGAATTTCGTGGATGCGTGTACTGTA
MAL13P1.118100500001754 MAL13P1.118 NC_004331 813666 GTAGCATCATATTAGTAGGTTCCGCCAAACCTGACTTTGTGCCTGAAATATATGTAGTAT
MAL13P1.119100500001755 MAL13P1.119 NC_004331 813667 CATAATTCGATCCACGCAGCTATGGTTACCCACCATTGCAACGTTTTAGTAAGTAAT
MAL13P1.120100500001756 MAL13P1.120 NC_004331 813670 GCACTGGTAGCAAAATAGCATTAATGCAGAAGCTTCAGAGGGATAGTATCATAGATCCTA
MAL13P1.121100500001759 MAL13P1.121 NC_004331 813671 TAATAATAACGATAGTGATAATACCATTGGGGTGCTTGAATTAGGTGGAGCAACCGCTCA
MAL13P1.126100500001764 MAL13P1.126 NC_004331 813676 TGAAAGGGATATTAAATCACATTCAAAGCAGACCCCATTATTCTGGGCCATATGCTCAAA
MAL13P1.129100500001768 MAL13P1.129 NC_004331 813679 AAGTGGTGAAAGCAGCCACTTCGTTGTGTAGGGTATATGGAGATTTATCTATTATGTCCA
MAL13P1.130100500001776 MAL13P1.130 NC_004331 813681 GGAACTGTATCATGGAGCTTGTCCCTTATATGTTTGATGGCCTCTTCGTACTATTTTGAT
MAL13P1.131100500001780 MAL13P1.131 NC_004331 813682 TCTATGTACATAACAGCCGTAGGATCATATATGCTCATACCCCCAAGCAGAATTGTTTGT
MAL13P1.132100500001781 MAL13P1.132 NC_004331 813683 TGACGAAGATGATGACGAAGACGATCCCGCTTCAGATGATGATTATATGAATGAAGGAAA
MAL13P1.133100500001782 MAL13P1.133 NC_004331 813684 ATACAGACCATCTTGGTTATAGAGGGATATCCCCTGCCCATAAAAATAATGACCCTA
MAL13P1.134100500001784 MAL13P1.134 NC_004331 813685 CTGGTTCAGGTAAATCCTTGACCCTCCTGACGTCTTTAATATATTGGTTGTGGAA
MAL13P1.135100500001786 MAL13P1.135 NC_004331 813686 TCATGCACGTCTTGTATGTGGAAGGACACAAAAAGGTACACGTGAAGTTATAGAACTTGA
MAL13P1.14100500001566 MAL13P1.14 NC_004331 813690 ACAAAATGGAGCCTCATGGTTCTTACGATGACAGTGACATGGATCATGAGAATATTTCCT
MAL13P1.146100500001831 MAL13P1.146 NC_004331 813697 TAAGTAGAAATATGAGACCCATGGCATTCAGGCCTCATTGTGGTGAAATCGGTAATATGA
MAL13P1.148100500001828 MAL13P1.148 NC_004331 813699 ATACGCATGATGATCCAAATAATGTGCGTAATTGCTATAGCACAGACACCAACCTAACGA
MAL13P1.150100500001822 MAL13P1.150 NC_004331 813702 GATTCTTTATGGGGAGAATTAATCTTTGCTTATGTCGCTTCAAAAATTACAGAACC
MAL13P1.16100500001571 MAL13P1.16 NC_004331 813712 ATGGCTTAATAGCTAGAGAAAAGACTGTGTTAGCAGAATATACCGAATATGGAGGAAAC
MAL13P1.160100500001838 MAL13P1.160 NC_004331 813713 GCATCTTAGTGAAGAGGATATGCAAGAATTAAGAGAAGAAGAGTTGAAAAGAAAATCGG

Total number of rows: 5367

Table truncated, full table size 565 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL15768_100712_Pfal_3D7_JM_exp.ndf.gz 4.5 Mb (ftp)(http) NDF
GPL15768_100712_Pfal_3D7_JM_exp.ngd.gz 155.2 Kb (ftp)(http) NGD

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap