NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL14937 Query DataSets for GPL14937
Status Public on Nov 30, 2011
Title Agilent-022830 RIKEN_AT_sORF0902
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Arabidopsis thaliana
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description This microarray targets 34546 mRNA-like transcripts inclusing 26254 annotated coding genes (TAIR8), 6,946 coding sORFs identified at Hanada et al (Genome Research 2007 17:632-640) and 1,346 novel transcripts verified by full length cDNAs. This microarray will be useful for scientists studying gene activity associated with various plant organ functions, stages of growth, and biotic and abiotic stresses.


Arrays of this design have barcodes that begin with 16022830 or 2522830.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Feature Extraction feature number.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.

 
Submission date Nov 29, 2011
Last update date Dec 06, 2011
Contact name Kousuke Hanada
E-mail(s) kohanada@bio.kyutech.ac.jp
Organization name Kyushu Institute Technology
Department Department of Bioscience and Bioinformatics
Street address 680-4 Kawazu
City Iizuka
State/province Fukuoka
ZIP/Postal code 820-8502
Country Japan
 
Samples (279) GSM843609, GSM843610, GSM843611, GSM843612, GSM843613, GSM843614 
Series (3)
GSE34188 Transcriptome analysis of annotated coding genes and sORF in 16 organs and 17 environmental conditions at A. thaliana
GSE49960 Transcriptome analysis of annotated coding genes and sORF under elevated CO2
GSE89805 Transcriptome analysis of annotated coding genes and sORF at 74 accessions of A. thaliana

Data table header descriptions
ID Agilent feature number
NAME NAME
SPOT_ID Spot identifier
CONTROL_TYPE Control type
GB_ACC GenBank Accession number
ORF ORF Name
GENE_SYMBOL Gene Symbol
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
DESCRIPTION Description
SEQUENCE Sequence

Data table
ID NAME SPOT_ID CONTROL_TYPE GB_ACC ORF GENE_SYMBOL ACCESSION_STRING CHROMOSOMAL_LOCATION DESCRIPTION SEQUENCE
ATRIKEN31987 ATRIKEN31987 ATRIKEN31987 FALSE unknown NEW_TU_6195|sORF|chr5_+_24367461-24367580 chr5:24367461-24367580 GC(40):NO_Xhybri CCCAAAGCCGGAGGAAGAGGAGACTATGAATTAGGAATTTATGATCATTTGGTGGTATTT
ATRIKEN13566 ATRIKEN13566 ATRIKEN13566 FALSE AT3G53520 UXS1_(UDP-GLUCURONIC_ACID_DECARBOXYLASE_1);_catalytic AT3G53520|TAIR|AT3G53520.1 chr3:19852613-19855035 GC(42):NO_Xhybri ACCATTCGCAAACACCCAATGACTGTTTATGGTGATGGAAAACAGACTCGTAGCTTTCAA
ATRIKEN08029 ATRIKEN08029 ATRIKEN08029 FALSE AT2G17880 DNAJ_heat_shock_protein,_putative AT2G17880|TAIR|AT2G17880.1 chr2:7774740-7774258 GC(40):NO_Xhybri CTGCATCACAAAACCCAAATCGGAACTTAAACCAAAAGACAAACAAAAACGCCGTCGTTT
ATRIKEN27822 ATRIKEN27822 ATRIKEN27822 FALSE unknown NEW_TU_1070|sORF|chr2_+_239319-239447 chr2:239319-239447 GC(40):NO_Xhybri AATATCAATGAAAGTCACAGCTGGCAGGAAATCTACGGTATCGTTATCTGGTGGACTTTT
ATRIKEN27713 ATRIKEN27713 ATRIKEN27713 FALSE unknown NEW_TU_952|sORF|chr2_+_5668190-5668303 chr2:5668190-5668303 GC(40):NO_Xhybri CTATATGGTAAACTCCGCGAAGCCGAGGATAGGTGGAAATAAAGTAAATGTGGGTTTAAT
ATRIKEN10969 ATRIKEN10969 ATRIKEN10969 FALSE AT2G13295 Encodes_a_Protease_inhibitor/seed_storage/LTP_family_protein AT2G13295|TAIR|AT2G13295.1 chr2:5521717-5521388 GC(43):NO_Xhybri CAAAACTTTGACTTTTATAAGCTCTCCAAACTCTCTCATGCATGCGGCGACCTCTTAGTC
ATRIKEN20199 ATRIKEN20199 ATRIKEN20199 FALSE AT4G26780 AR192;_adenyl-nucleotide_exchange_factor/_chaperone_binding_/_protein_binding_/_protein_homodimerization AT4G26780|TAIR|AT4G26780.1 chr4:13486566-13485072 GC(42):NO_Xhybri ATTCATTAGATGAACAAGATCTCCCATAAGTTGCTGGACATGGCATTTGCAGGGGAAATC
ATRIKEN30075 ATRIKEN30075 ATRIKEN30075 FALSE unknown NEW_TU_3849|sORF|chr1_-_3269217-3269342 chr1:3269342-3269217 GC(40):NO_Xhybri CGGTTATGATGGTAGCCATCAAGTGACATACGACCACAAAACCTTGAAAATGACTTTGTA
ATRIKEN30830 ATRIKEN30830 ATRIKEN30830 FALSE unknown NEW_TU_4763|sORF|chr4_+_3449846-3449944 chr4:3449846-3449944 GC(37):NO_Xhybri AAAGCTCACGCTGAAAATGCAATAGATGGTTCATCTATATTAAAGTGGAAGGGATCTTGA
ATRIKEN07335 ATRIKEN07335 ATRIKEN07335 FALSE AT2G48090 unknown_protein AT2G48090|TAIR|AT2G48090.1 chr2:19676799-19676290 GC(42):NO_Xhybri TCTTCCACCATTGCTCGTGCTAACCCGACTTTCAAGTGATGGATTTCGACAAATTAATGA
ATRIKEN13579 ATRIKEN13579 ATRIKEN13579 FALSE AT3G57860 UVI4-LIKE_(UV-B-INSENSITIVE_4-LIKE) AT3G57860|TAIR|AT3G57860.1 chr3:21437710-21438798 GC(42):NO_Xhybri ATCCTTACTTAGGAGAAGAGACCATAGAGGTATATCTGCTTAAAGGTTCCTGCACAGTGA
ATRIKEN14133 ATRIKEN14133 ATRIKEN14133 FALSE AT3G61750 auxin-responsive_protein_-related AT3G61750|TAIR|AT3G61750.1 chr3:22870229-22868872 GC(40):NO_Xhybri AATGGAGGAGATGGATGGAAAATTGGATATGGATTTGTTCTGTCAGTCACGTTACTTGCT
ATRIKEN11487 ATRIKEN11487 ATRIKEN11487 FALSE AT3G01730 unknown_protein AT3G01730|TAIR|AT3G01730.1 chr3:266635-266898 GC(38):NO_Xhybri CACCTCAACATTGATTAGTGCCTTGGCTTTCGTCTTCTAATATAAGACGTGTTTTTCTTC
ATRIKEN20010 ATRIKEN20010 ATRIKEN20010 FALSE AT4G02030 similar_to_unknown_protein_[Arabidopsis_thaliana]_(TAIR:AT1G21170.1);_similar_to_unnamed_protein_product_[Vitis_vinifera]_(GB:CAO40112.1);_similar_to_unknown_protein_[Oryza_sativa_(japonica_cultivar-group)]_(GB:AAR07074.1);_similar_to_unknown_protein_[Oryza_sativa_(japonica_cultivar-group)]_(GB:AAP03421.1);_contains_domain_PTHR15954_(PTHR15954) AT4G02030|TAIR|AT4G02030.1 chr4:892262-897175 GC(40):NO_Xhybri TTCACAAAGAGCTCGTAGTCAGCTTTTCGAGACACATCTTGCAAAACTGTTCAAGCAAAA
ATRIKEN12111 ATRIKEN12111 ATRIKEN12111 FALSE AT3G62910 APG3_(ALBINO_AND_PALE_GREEN);_translation_release_factor AT3G62910|TAIR|AT3G62910.1 chr3:23271361-23268636 GC(37):NO_Xhybri CTCGTTCAGAAAAGATAAGAACATACAATTATAAGGACAGTAGAGTGACTGATCATAGGC
ATRIKEN17481 ATRIKEN17481 ATRIKEN17481 FALSE AT4G18180 glycoside_hydrolase_family_28_protein_/_polygalacturonase_(pectinase)_family_protein AT4G18180|TAIR|AT4G18180.1 chr4:10065637-10067328 GC(40):NO_Xhybri TCTTGTAGAAACGTTAGAGCTAATTACATTGGGACTCAAATCCCACCTCCATGTCACTAA
ATRIKEN03251 ATRIKEN03251 ATRIKEN03251 FALSE AT1G08430 ALMT1/ATALMT1_(AL-ACTIVATED_MALATE_TRANSPORTER_1);_malate_transmembrane_transporter/ AT1G08430|TAIR|AT1G08430.1 chr1:2658797-2661026 GC(40):NO_Xhybri AAGCATTGGTCGTGCCATGCCAATAGATTCTCATGAAGATCATCATGTTGTCACAGTTTT
ATRIKEN01799 ATRIKEN01799 ATRIKEN01799 FALSE AT1G29390 COR314-TM2_(cold_regulated_314_thylakoid_membrane_2) AT1G29390|TAIR|AT1G29390.1 chr1:10287864-10286395 GC(42):NO_Xhybri GGAAACAGGAAGGTGCTATCCTTTCTTTAGCAATCTCTTGTTTTCTGGCTTTCCAGCATT
ATRIKEN23687 ATRIKEN23687 ATRIKEN23687 FALSE AT5G19390 pleckstrin_homology_(PH)_domain-containing_protein_/_RhoGAP_domain-containing_protein AT5G19390|TAIR|AT5G19390.1 chr5:6531908-6538208 GC(42):NO_Xhybri TCCCAAGATTTCATACACCGGCCATCATCTCCACCTTGGAACTAACAACATGAGAAAAAA
ATRIKEN21530 ATRIKEN21530 ATRIKEN21530 FALSE AT5G47470 nodulin_MtN21_family_protein AT5G47470|TAIR|AT5G47470.1 chr5:19271825-19273605 GC(38):NO_Xhybri TTCTCTGAAATTGAGAGTTTTGAGAGTGAGTTCGACTCTAAGAAGCCTCTTTTGTCTTGA

Total number of rows: 34415

Table truncated, full table size 8214 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap