Format

Send to:

Choose Destination

Links from Nucleotide

Sugano mouse kidney mkia

Identifiers
BioSample: SAMN00155884; EST: LIBEST_001300
Organism
Mus musculus (house mouse)
cellular organisms; Eukaryota; Opisthokonta; Metazoa; Eumetazoa; Bilateria; Deuterostomia; Chordata; Craniata; Vertebrata; Gnathostomata; Teleostomi; Euteleostomi; Sarcopterygii; Dipnotetrapodomorpha; Tetrapoda; Amniota; Mammalia; Theria; Eutheria; Boreoeutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus
Attributes
strainC57BL
sexfemale
development stageadult
lab hostDH10B
tissuekidney
vectorpME18S-FL3
v_typephagemid (ampicillin resistant)
re_1DraIII (CACTGTGTG)
re_2DraIII (CACCATGTG)
Description

1st strand cDNA was primed with an oligo(dT) primer [ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [TGTTGGCCTACTGG], digested and cloned into distinct DraIII sites of the pME18S-FL3 vector (5' site CACTGTGTG, 3' site CACCATGTG). XhoI should be used to isolate the cDNA insert. Size selection was performed to exclude fragments <1.5kb. Library constructed by Dr. Sumio Sugano (University of Tokyo Institute of Medical Science). Custom primers for sequencing: 5' end primer CTTCTGCTCTAAAAGCTGCG and 3' end primer CGACCTGCAGCTCGAGCACA.

Submission
Washington University School of Medicine, Marra M/WashU-NCI Mouse EST Project 1999; 1998-05-28
Accession:
SAMN00155884
ID:
155884

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center