GEO Profiles Links for Nucleotide (Select 576067909) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 333

<< First< Prev

Page of 17

Next >Last >>

Select item 301897201.

Sh3glb2 - High and low weight gainers: hypothalamus

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL2995, 921421 (ID_REF), GDS2320, NM_139302

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 30189720

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75259362.

Sh3glb2 - MPSS transcriptome analysis project

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCGACTGGCTCATTGG (ID_REF), GDS868, NM_139302

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7525936

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1278798143.

Sh3glb2 - White adipose tissue development

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2635240 (ID_REF), GDS5528, NM_139302

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 127879814

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1159190124.

Sh3glb2 - Auditory fear conditioning effect on amygdala: time course

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2635240 (ID_REF), GDS5157, NM_139302, SH3GLB2 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115919012

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756740675.

Sh3glb2 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL6481, 2030086 (ID_REF), GDS4002, NM_139302, Sh3glb2 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75674067

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1211006126.

Sh3glb2 - Kelch-like family member 40 deficiency effect on the skeletal muscle

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2635240 (ID_REF), GDS5295, NM_139302, SH3GLB2 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 121100612

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 616013127.

Sh3glb2 - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2635240 (ID_REF), GDS3582, NM_139302, SH3GLB2 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61601312

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1318683398.

Sh3glb2 - Short-term high fat diet effect on epididymal adipose fractions: time course

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL6246, 10481457 (ID_REF), GDS5824, NM_001289709, BC028859, NM_001289710, NM_139302, AF426314, AK129455, BC024477, EF676083, chr2:30344809-30359305 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 131868339

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1214021149.

Sh3glb2 - Negative elongation factor B subunit deficiency effect on the heart

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2635240 (ID_REF), GDS5302, NM_139302

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 121402114

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10327441210.

Sh3glb2 - MEKK2 and MEKK3 deficiency effect on CD26L(low)CD44(high) CD4 T cells

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2635240 (ID_REF), GDS4795, NM_139302, SH3GLB2 (ORF)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 103274412

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6259080811.

Sh3glb2 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL6333, scl19472.10_43-S (ID_REF), GDS3621, NM_139302, Sh3glb2 (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62590808

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13106261412.

Sh3glb2 - Radioactive iodine effect on normal thyroid: dose response

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2635240 (ID_REF), GDS5803, NM_139302

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 131062614

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12130261413.

Sh3glb2 - Restless Legs Syndrome model: adult whole brain

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2635240 (ID_REF), GDS5299, NM_139302

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 121302614

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5734643114.

Sh3glb2 - Kras G12D heterozygous mutation effect on somatic cell line (Sentrix MouseRef-8)

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL4865, scl19472.10_43-S (ID_REF), GDS3456, NM_139302

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 57346431

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12332781215.

Sh3glb2 - Casein kinase 1 α deficiency effect on leukemia stem cells

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2635240 (ID_REF), GDS5360, NM_139302, SH3GLB2 (ORF)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 123327812

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7462391216.

Sh3glb2 - Bone marrow mesenchymal stem cells and renal and cardiac MSC-like cells

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2635240 (ID_REF), GDS3974, NM_139302, SH3GLB2 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 74623912

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 766363617.

Sh3glb2 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCGACTGGCTCATTGG (ID_REF), GDS878, NM_139302

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7663636

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13177611218.

Sh3glb2 - αSMA+ myofibroblast late depletion effect on pancreatic ductal adenocarcinoma model

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2635240 (ID_REF), GDS5821, NM_139302, SH3GLB2 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131776112

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11882009219.

Sh3glb2 - Transcription factor engrailed-2 loss-of-function model of autism spectrum disorder: cerebellum

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P297647 (ID_REF), GDS5241, NM_139302, A_51_P297647 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118820092

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11816033920.

Sh3glb2 - Age effect on adipocytes of the bone marrow and epididymis

Annotation:: Sh3glb2, SH3-domain GRB2-like endophilin B2

Organism:: Mus musculus

Reporter:: GPL6246, 10481457 (ID_REF), GDS5226, NM_001289709, BC028859, NM_001289710, NM_139302, AF426314, AK129455, BC024477, EF676083, chr2:30344809-30359305 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 118160339

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 17

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 576067909) (333)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 333

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity