GEO Profiles Links for Nucleotide (Select 261824022) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 361

<< First< Prev

Page of 19

Next >Last >>

Select item 716808981.

Slc5a1 - Fasting effect on multiple tissues: time course

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL11012, 15398 (ID_REF), GDS3893, NM_019810

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71680898

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1193906732.

Slc5a1 - Chronic, low level drug exposure effect on obese liver

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P241863 (ID_REF), GDS5258, NM_019810, A_51_P241863 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119390673

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 921021293.

Slc5a1 - Conventionalization of germ-free C57BL/6 males: time course

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL11533, 10521038 (ID_REF), GDS4319, NM_019810, BC003845, chr5:33446868-33505346 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 144 samples

ID:: 92102129

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 518297414.

Slc5a1 - Interleukin-22 effect on colon cultures

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL2872, 41641 (ID_REF), GDS3226, NM_019810, A_51_P241863 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 51829741

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1239650815.

Slc5a1 - Homeobox protein Nanog transcription factor overexpression effect on colon and intestine cells

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2715270 (ID_REF), GDS5376, NM_019810

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 123965081

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 518018906.

Slc5a1 - Interleukin-22 effect on colon cultures

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL2872, 13790 (ID_REF), GDS3226, NM_019810, A_52_P669128 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 51801890

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1194220607.

Slc5a1 - Chronic, low level drug exposure effect on obese liver

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P669128 (ID_REF), GDS5258, NM_019810, A_52_P669128 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119422060

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74789318.

Slc5a1 - MPSS transcriptome analysis project

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCATCTCCTTCCTCACCA (ID_REF), GDS868, NM_019810

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7478931

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1125188639.

Slc5a1 - Irradiation effect on peripheral blood mononuclear cells: dose response

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL4783, M300001120 (ID_REF), GDS2645, NM_019810, AF163846

DataSet type:: Expression profiling by array, log2 ratio, 28 samples

ID:: 112518863

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13271923010.

Slc5a1 - Diet-induced obesity model: white adipose tissue

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2715270 (ID_REF), GDS6247, NM_019810, SLC5A1 (ORF)

DataSet type:: Expression profiling by array, transformed count, 40 samples

ID:: 132719230

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11249586411.

Slc5a1 - Wnt4 mutation effect on female embryonic gonads

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL3108, 5764 (ID_REF), GDS2574, NM_019810

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 112495864

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10921984612.

Slc5a1 - Diabetic db/db heart response to rosiglitazone

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL4134, 9946 (ID_REF), GDS4990, NM_019810, A_51_P241863 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109219846

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8812650113.

Slc5a1 - Sox9+ pancreatic cells: developmental time course

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL6246, 10521038 (ID_REF), GDS4335, NM_019810, AF163846, AF208031, AK085602, BC003845, chr5:33104219-33162697 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 88126501

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8472460114.

Slc5a1 - DSS-induced colitis model response to enhanced siRNA targeting of Tumor necrosis factor α

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL6246, 10521038 (ID_REF), GDS4371, NM_019810, AF163846, AF208031, AK085602, BC003845, chr5:33104219-33162697 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 84724601

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8246194615.

Slc5a1 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2471545 (ID_REF), GDS3720, NM_019810

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82461946

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7936460116.

Slc5a1 - Diabetogenic 3A9 T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL6246, 10521038 (ID_REF), GDS4115, NM_019810, AF163846, AF208031, AK085602, BC003845, chr5:33104219-33162697 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 79364601

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2156213517.

Slc5a1 - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL1942, 12135 (ID_REF), GDS1882, NM_019810

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21562135

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10905150118.

Slc5a1 - Phorbol ester effect on skin of Rho exchange factor Vav2/Vav3 double knockout mutants: time course

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL6246, 10521038 (ID_REF), GDS4985, NM_019810, AF163846, AF208031, AK085602, BC003845, chr5:33104219-33162697 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 17 samples

ID:: 109051501

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8246789719.

Slc5a1 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2715270 (ID_REF), GDS3720, NM_019810

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82467897

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5537689620.

Slc5a1 - Heart failure progression model: non-infarcted ventricular tissue

Annotation:: Slc5a1, solute carrier family 5 (sodium/glucose cotransporter), member 1

Organism:: Mus musculus

Reporter:: GPL891, 1196 (ID_REF), GDS3386, NM_019810, A_51_P241868 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 55376896

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 19

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 261824022) (361)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 361

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity