GEO Profiles Links for Nucleotide (Select 257096007) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 361

<< First< Prev

Page of 19

Next >Last >>

Select item 719159101.

Mapk8ip2 - Fear conditioning effect on hybrid mouse diversity panel: hippocampus and striatum

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3161718 (ID_REF), GDS3900, NM_021921

DataSet type:: Expression profiling by array, count, 198 samples

ID:: 71915910

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 59497882.

Mapk8ip2 - High fat diet effect on aorta: time course

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL891, 488 (ID_REF), GDS735, NM_021921, A_51_P370400 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 54 samples

ID:: 5949788

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 968278903.

Mapk8ip2 - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10426244 (ID_REF), GDS4486, NM_021921, AF220195, AF310135, BC029704, chr15:89454130-89462904 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96827890

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 616000384.

Mapk8ip2 - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3161718 (ID_REF), GDS3582, NM_021921, MAPK8IP2 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61600038

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756621025.

Mapk8ip2 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL6481, 630373 (ID_REF), GDS4002, NM_021921, Mapk8ip2 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75662102

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 91804186.

Mapk8ip2 - Skeletal muscle response to voluntary running: time course

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL254, 1045 (ID_REF), GDS1019, NM_021921

DataSet type:: Expression profiling by array, log ratio, 7 samples

ID:: 9180418

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1159177387.

Mapk8ip2 - Auditory fear conditioning effect on amygdala: time course

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3161718 (ID_REF), GDS5157, NM_021921, MAPK8IP2 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115917738

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 662008108.

Mapk8ip2 - X chromosome dosage model

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_3161718 (ID_REF), GDS3728, NM_021921

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 66200810

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75229039.

Mapk8ip2 - MPSS transcriptome analysis project

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTAGCCCCCAAACTCA (ID_REF), GDS868, NM_021921

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7522903

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 8087039010.

Mapk8ip2 - Dopaminergic transcription factors Ascl1, Lmx1a, Nurr1 combined effect on embryonic fibroblasts

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10426244 (ID_REF), GDS4155, NM_021921, AF220195, AF310135, BC029704, chr15:89454130-89462904 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 80870390

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12129701011.

Mapk8ip2 - Restless Legs Syndrome model: adult whole brain

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3161718 (ID_REF), GDS5299, NM_021921

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 121297010

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9272529012.

Mapk8ip2 - Zinc finger transcription factor Fezf1 deficiency effect on main olfactory epithelial cells

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10426244 (ID_REF), GDS4446, NM_021921, AF220195, AF310135, BC029704, chr15:89454130-89462904 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 92725290

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6530097213.

Mapk8ip2 - Addictive drugs effect on brain striatum: time course

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2495555 (ID_REF), GDS3703, NM_021921

DataSet type:: Expression profiling by array, transformed count, 108 samples

ID:: 65300972

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2143447214.

Mapk8ip2 - Integrin beta-6 deficiency model of emphysema: alveolar macrophage

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL1792, M200009954 (ID_REF), GDS1874, NM_021921

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 21434472

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12259451215.

Mapk8ip2 - Mitochondrial complex I inhibitor rotenone effect on primary cortical neurons: time course

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_3161718 (ID_REF), GDS5341, NM_021921

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 122594512

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7564788316.

Mapk8ip2 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL6481, 102760097 (ID_REF), GDS4002, NM_021921, Mapk8ip2 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75647883

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13045701817.

Mapk8ip2 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P370392 (ID_REF), GDS5666, NM_021921, A_52_P370392 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130457018

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7167909118.

Mapk8ip2 - Fasting effect on multiple tissues: time course

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL11012, 13591 (ID_REF), GDS3893, NM_021921

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71679091

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12909199019.

Mapk8ip2 - Circadian nuclear receptor REV-ERBα deficiency effect on ventral midbrain

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL6246, 10426244 (ID_REF), GDS5628, NM_021921, AF220195, AF310135, BC029704, chr15:89454130-89462904 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129091990

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11626483820.

Mapk8ip2 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Mapk8ip2, mitogen-activated protein kinase 8 interacting protein 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3161718 (ID_REF), GDS5172, NM_021921, MAPK8IP2 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116264838

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 19

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 257096007) (361)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 361

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity