GEO Profiles Links for Nucleotide (Select 19527255) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 1219

<< First< Prev

Page of 61

Next >Last >>

Select item 569375461.

Ddx1 - Vancomycin effect on the kidney: dose response

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415915_at (ID_REF), GDS3435, 104721 (Gene ID), NM_134040

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 56937546

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 922768462.

Ddx1 - Rough attenuated Brucella suis strain infection effect on macrophage cell line: time course

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415915_at (ID_REF), GDS4432, 104721 (Gene ID), NM_134040

DataSet type:: Expression profiling by array, count, 42 samples

ID:: 92276846

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 395894873.

Ddx1 - Wilms' tumor protein Wt1 deficiency effect on the urogenital ridge

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL1524, 17687 (ID_REF), GDS2747, NM_134040

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 39589487

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 370008464.

Ddx1 - Asthma model: lungs

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415915_at (ID_REF), GDS2647, 104721 (Gene ID), NM_134040

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 37000846

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 929757465.

Ddx1 - Wild type embryonic tooth germ tissue

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415915_at (ID_REF), GDS4453, 104721 (Gene ID), NM_134040

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 92975746

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 728486116.

Ddx1 - Spatial and temporal development of mammalian salivary glands

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P424563 (ID_REF), GDS3922, NM_134040, A_52_P424563 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72848611

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 504360467.

Ddx1 - Homeodomain transcription factor EMX2 deficiency effect on the embryonic urogenital epithelium

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415915_at (ID_REF), GDS3173, 104721 (Gene ID), NM_134040

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 50436046

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 475052468.

Ddx1 - Transcription factor Sp3 deficiency effect on the embryonic heart

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415915_at (ID_REF), GDS3058, 104721 (Gene ID), NM_134040

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 47505246

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 152870469.

Ddx1 - Transcription factor RUNX1 knockout

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415915_at (ID_REF), GDS1511, 104721 (Gene ID), NM_134040

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 15287046

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11579734610.

Ddx1 - Wild type, postnatal day 7 motor neuron populations

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415915_at (ID_REF), GDS5114, 104721 (Gene ID), NM_134040

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 115797346

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11312664611.

Ddx1 - An in vitro primordial germ cell specification system: time course

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415915_at (ID_REF), GDS4870, 104721 (Gene ID), NM_134040

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 113126646

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8672024612.

Ddx1 - Histone methyltransferase H3K79 Dot1l deletion effect on MLL-AF9 leukemia cells: time course

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415915_at (ID_REF), GDS4295, 104721 (Gene ID), NM_134040

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 86720246

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6197168313.

Ddx1 - Eset depletion effect on embryonic stem cell

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL6333, scl42615.25.8_1-S (ID_REF), GDS3599, NM_134040, Ddx1 (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61971683

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5911614614.

Ddx1 - Transcription factor Klf5 deficiency effect on embryonic stem cells

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415915_at (ID_REF), GDS3509, 104721 (Gene ID), NM_134040

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 59116146

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4695422015.

Ddx1 - Histone H3 lysine 9 demethylase depletion effect on embryonic stem cells

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL4234, 3450047 (ID_REF), GDS3037, NM_134040

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 46954220

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4101364616.

Ddx1 - Dexamethasone effect on fetal chondrocytes in vitro: time course

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415915_at (ID_REF), GDS2802, 104721 (Gene ID), NM_134040

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 41013646

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2938294617.

Ddx1 - Embryonic stem cell line response to the conditional expression of neurogenin 3

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415915_at (ID_REF), GDS2276, 104721 (Gene ID), NM_134040

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 29382946

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 765540418.

Ddx1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCGGCAGAGTGGGACGAG (ID_REF), GDS878, NM_134040

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7655404

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9787764619.

Ddx1 - KrasG12D pancreatic ductal epithelial cells deficient in PTEN

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415915_at (ID_REF), GDS4528, 104721 (Gene ID), NM_134040

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 97877646

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9677294620.

Ddx1 - MYBL1 transcription factor knockout effect on testes

Annotation:: Ddx1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415915_at (ID_REF), GDS4485, 104721 (Gene ID), NM_134040

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 96772946

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 61

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 19527255) (1219)
GEO Profiles
EPHA4 EPH receptor A4 [Homo sapiens]
EPHA4 EPH receptor A4 [Homo sapiens]
Gene ID:2043

Gene
Gene Links for GEO Profiles (Select 104925603) (1)
Gene

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 1219

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity