GEO Profiles Links for Nucleotide (Select 18043924) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 157

<< First< Prev

Page of 8

Next >Last >>

Select item 990359331.

Dimt1 - Spleen response to acute LCMV-Armstrong and persistent LCMV-Clone13 infections: time course

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10407042 (ID_REF), GDS4556, NM_025447, XM_006517735, XM_006517736, BC019799, chr13:106947156-106960224 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 26 samples

ID:: 99035933

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1161363332.

Dimt1 - In vitro-differentiated CD4+ T helper cell subsets

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10407042 (ID_REF), GDS5166, NM_025447, XM_006517735, XM_006517736, BC019799, chr13:106947156-106960224 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 116136333

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1046878333.

Dimt1 - Tropomodulin3 deficiency effect on the fetal liver

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10407042 (ID_REF), GDS4827, NM_025447, XM_006517735, XM_006517736, BC019799, chr13:106947156-106960224 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 104687833

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1147888334.

Dimt1 - Kidney epithelium cell line response to adaptive mutations in Influenza A virus (H3N2) non-structural 1 gene

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10407042 (ID_REF), GDS4996, NM_025447, XM_006517735, XM_006517736, BC019799, chr13:106947156-106960224 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 42 samples

ID:: 114788833

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1158501335.

Dimt1 - Neuro2a neuroblastoma cell lines: anchorage dependent cells and anchorage independent tumorspheres

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10407042 (ID_REF), GDS5140, NM_025447, XM_006517735, XM_006517736, BC019799, chr13:106947156-106960224 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 115850133

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1219020336.

Dimt1 - Embryonic fibroblast response to ectopic expression of transcription factors Oct4, Sox2, Klf4, c-Myc: time course

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10407042 (ID_REF), GDS5316, NM_025447, XM_006517735, XM_006517736, BC019799, chr13:106947156-106960224 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 121902033

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1155200337.

Dimt1 - Transciption factor Meis1 deficiency effect on lineage-negative bone marrow cells

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10407042 (ID_REF), GDS5095, NM_025447, XM_006517735, XM_006517736, BC019799, chr13:106947156-106960224 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 115520033

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1143531338.

Dimt1 - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10407042 (ID_REF), GDS4946, NM_025447, XM_006517735, XM_006517736, BC019799, chr13:106947156-106960224 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114353133

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 941857339.

Dimt1 - Endoplasmic reticulum thiol oxidase deficiency effect on embryonic fibroblasts

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10407042 (ID_REF), GDS4507, NM_025447, XM_006517735, XM_006517736, BC019799, chr13:106947156-106960224 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 94185733

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10869213310.

Dimt1 - Ubiquitin specific protease 22 depletion effect on embryonic stem cell line

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10407042 (ID_REF), GDS4973, NM_025447, XM_006517735, XM_006517736, BC019799, chr13:106947156-106960224 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 108692133

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10676203311.

Dimt1 - TGFβ inhibitor effect on induced cardiomyocytes

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10407042 (ID_REF), GDS4898, NM_025447, XM_006517735, XM_006517736, BC019799, chr13:106947156-106960224 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 27 samples

ID:: 106762033

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 762749812.

Dimt1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1010, GATCACTTTTGTTCGGAAAA (ID_REF), GDS878, BC019799

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7627498

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 748979813.

Dimt1 - MPSS transcriptome analysis project

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1010, GATCACTTTTGTTCGGAAAA (ID_REF), GDS868, BC019799

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7489798

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12973753314.

Dimt1 - v-raf murine sarcoma viral oncogene homolog B-mutant thyroid carcinoma tumors

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10407042 (ID_REF), GDS5645, NM_025447, XM_006517735, XM_006517736, BC019799, chr13:106947156-106960224 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 129737533

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11485983315.

Dimt1 - Kidney epithelium cell line response to Influenza A virus (H3N2) non-structural 1 gene mutations

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10407042 (ID_REF), GDS4998, NM_025447, XM_006517735, XM_006517736, BC019799, chr13:106947156-106960224 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 114859833

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11234543316.

Dimt1 - Embryonic fibroblast in vitro model of hypothermia: time course

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10407042 (ID_REF), GDS5092, NM_025447, XM_006517735, XM_006517736, BC019799, chr13:106947156-106960224 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 112345433

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10808803317.

Dimt1 - Prostate cancer cell line response to overexpression of Twist1 and Twist1 mutants

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10407042 (ID_REF), GDS4955, NM_025447, XM_006517735, XM_006517736, BC019799, chr13:106947156-106960224 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 108088033

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13039813318.

Dimt1 - Pathogen-associated molecular-pattern curdlan effect on interleukin-2 deficient GM-CSF myeloid dendritic cells

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10407042 (ID_REF), GDS5665, NM_025447, XM_006517735, XM_006517736, BC019799, chr13:106947156-106960224 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 130398133

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13021859519.

Dimt1 - Interleukin 7 and FLT-3 ligand effect on EML1 HSPC line expressing acute lymphoblastic leukemia TEL-AML1 fusion protein: time course

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL11533, 10407042 (ID_REF), GDS5661, NM_025447, BC019799, chr13:107737236-107750304 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130218595

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10884853320.

Dimt1 - Light-induced retinal damage

Annotation:: Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL6246, 10407042 (ID_REF), GDS4980, NM_025447, XM_006517735, XM_006517736, BC019799, chr13:106947156-106960224 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 108848533

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 8

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 18043924) (157)
GEO Profiles
BioSample links for Nucleotide (Select 2724289488) (0)
BioSample

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 157

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity