GEO Profile Links for Gene (Select 67504) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1295

<< First< Prev

Page of 65

Next >Last >>

Select item 294482721.

Rnf151 - Ribonucleoprotein- and polysome-associated mRNAs of the testis: time-course

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL339, 1451009_at (ID_REF), GDS2277, 67504 (Gene ID), AK005854

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 29448272

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 47898282.

Rnf151 - Spermatogenesis and testis development time course (MG-U74C)

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL83, 165486_i_at (ID_REF), GDS607, 67504 (Gene ID), AV204790

DataSet type:: Expression profiling by array, count, 22 samples

ID:: 4789828

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 424572043.

Rnf151 - Taf7l deficiency effect on the testis

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL1261, 1451009_at (ID_REF), GDS2857, 67504 (Gene ID), AK005854

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 42457204

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 26843284.

Rnf151 - Spermatogenesis time course (MG-U74C)

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL83, 165486_i_at (ID_REF), GDS410, 67504 (Gene ID), AV204790

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 2684328

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 940285045.

Rnf151 - Gonadal development: ovaries and testes

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL1261, 1451009_at (ID_REF), GDS4503, 67504 (Gene ID), AK005854

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 94028504

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 314640046.

Rnf151 - Male germ cells

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL1261, 1451009_at (ID_REF), GDS2390, 67504 (Gene ID), AK005854

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 31464004

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74872357.

Rnf151 - MPSS transcriptome analysis project

Annotation:: Rnf151, Ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCAACCTCTTTGCCAG (ID_REF), GDS868, BU938870

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7487235

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1031911048.

Rnf151 - Mitochondrial protease Clpp knockout effect on various tissues

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL11180, 1451009_PM_at (ID_REF), GDS4791, AK005854

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 103191104

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 280130049.

Rnf151 - Spinal cord and dorsal root ganglion

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL1261, 1451009_at (ID_REF), GDS2209, 67504 (Gene ID), AK005854

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 28013004

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 437167210.

Rnf151 - Sex specific transcription in somatic and reproductive tissues

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL339, 1451009_at (ID_REF), GDS565, 67504 (Gene ID), AK005854

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 4371672

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7220100411.

Rnf151 - Polyubiquitin knockout effect on testis: time course

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL1261, 1451009_at (ID_REF), GDS3906, 67504 (Gene ID), AK005854

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 72201004

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4988930412.

Rnf151 - Various tissues

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL1261, 1451009_at (ID_REF), GDS3142, 67504 (Gene ID), AK005854

DataSet type:: Expression profiling by array, count, 70 samples

ID:: 49889304

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8903620413.

Rnf151 - Nitric oxide generator DETA-NONOate effect on in vitro neuronal injury model: time course

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL1261, 1451009_at (ID_REF), GDS4408, 67504 (Gene ID), AK005854

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 89036204

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5729780414.

Rnf151 - Murine model of primary mitochondrial dysfunction

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL1261, 1451009_at (ID_REF), GDS3454, 67504 (Gene ID), AK005854

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 57297804

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 569172815.

Rnf151 - Spermatogonial stem cell activity in testis laminin binding germ cells (MG-U74C )

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL83, 165486_i_at (ID_REF), GDS704, 67504 (Gene ID), AV204790

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 5691728

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3882767216.

Rnf151 - Pubertal mammary gland development

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL339, 1451009_at (ID_REF), GDS2721, 67504 (Gene ID), AK005854

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 38827672

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10397250417.

Rnf151 - GPR120-deficient white adipose tissue response to a high fat diet

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL1261, 1451009_at (ID_REF), GDS4811, 67504 (Gene ID), AK005854

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 103972504

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12259430118.

Rnf151 - Mitochondrial complex I inhibitor rotenone effect on primary cortical neurons: time course

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2648122 (ID_REF), GDS5341, NM_026205

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 122594301

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11228120419.

Rnf151 - Cystatin B knockout model of progressive myoclonus epilepsy: postnatal day 30 cerebellum

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL1261, 1451009_at (ID_REF), GDS5090, 67504 (Gene ID), AK005854

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 112281204

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7283209320.

Rnf151 - Spatial and temporal development of mammalian salivary glands

Annotation:: Rnf151, ring finger protein 151

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P405314 (ID_REF), GDS3922, NM_026205, A_51_P405314 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72832093

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 65

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 67504) (1295)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1295

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity