GEO Profile Links for Gene (Select 66729) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1258

<< First< Prev

Page of 63

Next >Last >>

Select item 1162697921.

Ankrd61 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1218097 (ID_REF), GDS5172, NM_025732, 4921520G13RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116269792

Select item 529578242.

Ankrd61 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL2872, 11424 (ID_REF), GDS3259, NM_025732, A_51_P189704 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52957824

Select item 280113953.

Ankrd61 - Spinal cord and dorsal root ganglion

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL1261, 1449395_at (ID_REF), GDS2209, 66729 (Gene ID), NM_025732

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 28011395

Select item 314623954.

Ankrd61 - Male germ cells

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL1261, 1449395_at (ID_REF), GDS2390, 66729 (Gene ID), NM_025732

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 31462395

Select item 940268955.

Ankrd61 - Gonadal development: ovaries and testes

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL1261, 1449395_at (ID_REF), GDS4503, 66729 (Gene ID), NM_025732

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 94026895

Select item 388261076.

Ankrd61 - Pubertal mammary gland development

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL339, 1449395_at (ID_REF), GDS2721, 66729 (Gene ID), NM_025732

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 38826107

Select item 129948807.

Ankrd61 - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL891, 10980 (ID_REF), GDS1359, NM_025732, A_51_P189704 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 12994880

Select item 1031894958.

Ankrd61 - Mitochondrial protease Clpp knockout effect on various tissues

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL11180, 1449395_PM_at (ID_REF), GDS4791, NM_025732

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 103189495

Select item 1326945929.

Ankrd61 - Diet-induced obesity model: white adipose tissue

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1218097 (ID_REF), GDS6247, NM_025732, 4921520G13RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 40 samples

ID:: 132694592

Select item 7573536710.

Ankrd61 - Cyclophosphamide effect on splenocytes: time course

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL13209, 032M19 (ID_REF), GDS4005, NM_025732

DataSet type:: Expression profiling by array, log2 ratio, 38 samples

ID:: 75735367

Select item 746367011.

Ankrd61 - MPSS transcriptome analysis project

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL1010, GATCGCTTCTGGCCAGACTA (ID_REF), GDS868, BC052346

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7463670

Select item 4245559512.

Ankrd61 - Taf7l deficiency effect on the testis

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL1261, 1449395_at (ID_REF), GDS2857, 66729 (Gene ID), NM_025732

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 42455595

Select item 9542979513.

Ankrd61 - Aged, lupus-prone MRL/Faslpr model: splenic CD4 T cells

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL1261, 1449395_at (ID_REF), GDS4190, 66729 (Gene ID), NM_025732

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 95429795

Select item 8358119514.

Ankrd61 - Non-obese diabetic (NOD) and disease-resistant NOD.NOR-Chr4 models: splenic B cells

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL1261, 1449395_at (ID_REF), GDS4340, 66729 (Gene ID), NM_025732

DataSet type:: Expression profiling by array, transformed count, 11 samples

ID:: 83581195

Select item 2944670715.

Ankrd61 - Ribonucleoprotein- and polysome-associated mRNAs of the testis: time-course

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL339, 1449395_at (ID_REF), GDS2277, 66729 (Gene ID), NM_025732

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 29446707

Select item 8903459516.

Ankrd61 - Nitric oxide generator DETA-NONOate effect on in vitro neuronal injury model: time course

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL1261, 1449395_at (ID_REF), GDS4408, 66729 (Gene ID), NM_025732

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 89034595

Select item 7219939517.

Ankrd61 - Polyubiquitin knockout effect on testis: time course

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL1261, 1449395_at (ID_REF), GDS3906, 66729 (Gene ID), NM_025732

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 72199395

Select item 4415738518.

Ankrd61 - Testis response to histone deacetylase inhibitor trichostatin A: time course

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL4053, 2785 (ID_REF), GDS2923, NM_025732

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 44157385

Select item 437010719.

Ankrd61 - Sex specific transcription in somatic and reproductive tissues

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL339, 1449395_at (ID_REF), GDS565, 66729 (Gene ID), NM_025732

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 4370107

Select item 12258623020.

Ankrd61 - Mitochondrial complex I inhibitor rotenone effect on primary cortical neurons: time course

Annotation:: Ankrd61, ankyrin repeat domain 61

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_1218097 (ID_REF), GDS5341, NM_025732

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 122586230

<< First< Prev

Page of 63

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 66729) (1258)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to: