GEO Profile Links for Gene (Select 224613) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 2119

<< First< Prev

Page of 106

Next >Last >>

Select item 26670261.

Flywch1 - Spermatogenesis time course (MG-U74B)

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL82, 106200_at (ID_REF), GDS409, 224613 (Gene ID), AI842120

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 2667026

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756557842.

Flywch1 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL6481, 3360541 (ID_REF), GDS4002, NM_153791, E030034P13Rik (CLONE ID)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75655784

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75098463.

Flywch1 - MPSS transcriptome analysis project

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCGTGTGCGCTCCATG (ID_REF), GDS868, BC025645

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7509846

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 47725264.

Flywch1 - Spermatogenesis and testis development time course (MG-U74B)

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL82, 106200_at (ID_REF), GDS606, 224613 (Gene ID), AI842120

DataSet type:: Expression profiling by array, count, 22 samples

ID:: 4772526

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 625728745.

Flywch1 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL6333, scl00224613.2_5-S (ID_REF), GDS3621, NM_153791, E030034P13Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62572874

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 439778886.

Flywch1 - Various brain regions of several inbred strains

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426982_at (ID_REF), GDS2917, 224613 (Gene ID), BB477613

DataSet type:: Expression profiling by array, count, 61 samples

ID:: 43977888

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 170123887.

Flywch1 - Nodose and dorsal root ganglia comparison (MG-430 2.0)

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426982_at (ID_REF), GDS1635, 224613 (Gene ID), BB477613

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 17012388

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 47757278.

Flywch1 - Spermatogenesis and testis development time course (MG-U74B)

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL82, 111204_at (ID_REF), GDS606, 224613 (Gene ID), AI841766

DataSet type:: Expression profiling by array, count, 22 samples

ID:: 4775727

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44870209.

Flywch1 - Zygotic gene activation

Annotation:: Flywch1, FLYWCH-type zinc finger 1 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 17920 (ID_REF), GDS579, AK013108, AK019378, BC025645, L0032G12-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4487020

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6529504710.

Flywch1 - Addictive drugs effect on brain striatum: time course

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_1248438 (ID_REF), GDS3703, NM_153791

DataSet type:: Expression profiling by array, transformed count, 108 samples

ID:: 65295047

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5526842711.

Flywch1 - Visual cortex during the critical period for ocular dominance (MG-U74B)

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL82, 111204_at (ID_REF), GDS3376, 224613 (Gene ID), AI841766

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 55268427

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5526522612.

Flywch1 - Visual cortex during the critical period for ocular dominance (MG-U74B)

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL82, 106200_at (ID_REF), GDS3376, 224613 (Gene ID), AI842120

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 55265226

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4318978813.

Flywch1 - Cerebral cortex and hypothalamus response to sleep and sleep deprivation: time course

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426982_at (ID_REF), GDS2882, 224613 (Gene ID), BB477613

DataSet type:: Expression profiling by array, count, 90 samples

ID:: 43189788

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3143998814.

Flywch1 - Male germ cells

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426982_at (ID_REF), GDS2390, 224613 (Gene ID), BB477613

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 31439988

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2319332615.

Flywch1 - Primary visual cortex response to visual input deprivation (MG-U74B)

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL82, 106200_at (ID_REF), GDS1984, 224613 (Gene ID), AI842120

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 23193326

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1553127716.

Flywch1 - Forebrain neuronal subtypes

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL339, 1426982_at (ID_REF), GDS1522, 224613 (Gene ID), BB477613

DataSet type:: Expression profiling by array, count, 42 samples

ID:: 15531277

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8247071917.

Flywch1 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2459045 (ID_REF), GDS3720, NM_153791

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82470719

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4544398818.

Flywch1 - Vitamin E supplementation effect on aged brain

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426982_at (ID_REF), GDS2973, 224613 (Gene ID), BB477613

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 45443988

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4400316219.

Flywch1 - Various brain regions of several inbred strains

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL1261, 1452267_at (ID_REF), GDS2917, 224613 (Gene ID), BB477613

DataSet type:: Expression profiling by array, count, 61 samples

ID:: 44003162

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4135966220.

Flywch1 - Morphine effect on the striatum

Annotation:: Flywch1, FLYWCH-type zinc finger 1

Organism:: Mus musculus

Reporter:: GPL1261, 1452267_at (ID_REF), GDS2815, 224613 (Gene ID), BB477613

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 41359662

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 106

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 224613) (2119)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 2119

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity