GEO Profile Links for Gene (Select 16801) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 2378

<< First< Prev

Page of 119

Next >Last >>

Select item 880299701.

Arhgef1 - Interleukin-2 null effect on the regulatory T cell-deficient scurfy model of autoimmune disease: CD4+ T-cells

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL1261, 1421164_a_at (ID_REF), GDS4333, 16801 (Gene ID), NM_008488

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 88029970

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74793892.

Arhgef1 - MPSS transcriptome analysis project

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGCTAAGCACTGAGG (ID_REF), GDS868, BC012488

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7479389

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1280151703.

Arhgef1 - Transcription factor Inhibitor of differentiation 3 knockout effect on invariant natural killer T cells: developmental time course

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL1261, 1421164_a_at (ID_REF), GDS5602, 16801 (Gene ID), NM_008488

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 128015170

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1098707704.

Arhgef1 - Nonobese diabetic NOD spleen CD4 T-cells: 3-week old females

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL1261, 1421164_a_at (ID_REF), GDS5019, 16801 (Gene ID), NM_008488

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 109870770

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 898196705.

Arhgef1 - Niemann-Pick Type C disease spleen: time course

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL1261, 1421164_a_at (ID_REF), GDS4428, 16801 (Gene ID), NM_008488

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 89819670

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 697647706.

Arhgef1 - Retinoic acid effect on CD4+ T cells from spleen/lymph nodes

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL1261, 1421164_a_at (ID_REF), GDS3840, 16801 (Gene ID), NM_008488

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 69764770

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 613853707.

Arhgef1 - Cbfbeta deficiency effect on regulatory T cells

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL1261, 1421164_a_at (ID_REF), GDS3577, 16801 (Gene ID), NM_008488

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61385370

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 592373708.

Arhgef1 - Furin deficiency effect on T-cells

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL1261, 1421164_a_at (ID_REF), GDS3512, 16801 (Gene ID), NM_008488

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 59237370

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 455883459.

Arhgef1 - Ultrafine particles effect on ovalbumin-sensitized lungs

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL4636, 6245 (ID_REF), GDS2976, NM_008488

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 45588345

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3862807010.

Arhgef1 - Polycomb group protein Ezh2 deficiency effect on lymph node T cells

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL1261, 1421164_a_at (ID_REF), GDS2717, 16801 (Gene ID), NM_008488

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 38628070

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3683727011.

Arhgef1 - Multiple myeloma model

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL1261, 1421164_a_at (ID_REF), GDS2640, 16801 (Gene ID), NM_008488

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 36837270

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1280204212.

Arhgef1 - Bruton's tyrosine kinase mutant models of X-linked agammaglobulinemia

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL81, 98001_at (ID_REF), GDS1346, 16801 (Gene ID), U58203

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 12802042

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 927635913.

Arhgef1 - IL-21 and IL-15 synergistic effect on naïve CD8+ T cells

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL339, 1421164_a_at (ID_REF), GDS1030, 16801 (Gene ID), NM_008488

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 9276359

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12134937014.

Arhgef1 - Androgen deprivation effect on CD4 T-cells

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL11180, 1421164_PM_a_at (ID_REF), GDS5301, NM_008488

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 121349370

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10991727015.

Arhgef1 - Nonobese diabetic NOD spleen CD4 T-cells: 4-week old females

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL1261, 1421164_a_at (ID_REF), GDS5020, 16801 (Gene ID), NM_008488

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 109917270

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10982427016.

Arhgef1 - Nonobese diabetic NOD spleen CD4 T-cells: 2-week old females

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL1261, 1421164_a_at (ID_REF), GDS5018, 16801 (Gene ID), NM_008488

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 109824270

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7511034217.

Arhgef1 - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL6246, 10551030 (ID_REF), GDS3987, NM_001130150, NM_001130151, NM_001130152, NM_001130153, NM_008488, BC012488, U58203, chr7:24903049-24926592 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75110342

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7471057018.

Arhgef1 - Premature Hematopoietic Aging model: bone marrow hematopoietic stem cells

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL1261, 1421164_a_at (ID_REF), GDS3976, 16801 (Gene ID), NM_008488

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 74710570

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5964265319.

Arhgef1 - Lung response to aerosolized non-typeable Haemophilus influenza lysate: time course

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_1247180 (ID_REF), GDS3522, NM_008488

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 59642653

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3441825920.

Arhgef1 - Effect of gonadal steroids on sex differences in response to blood-stage malaria infection: time course

Annotation:: Arhgef1, Rho guanine nucleotide exchange factor (GEF) 1

Organism:: Mus musculus

Reporter:: GPL339, 1421164_a_at (ID_REF), GDS2524, 16801 (Gene ID), NM_008488

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 34418259

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 119

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 16801) (2378)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 2378

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity