GEO Profile Links for Gene (Select 15492) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1762

<< First< Prev

Page of 89

Next >Last >>

Select item 1013029531.

Hsd3b1 - Mutated anaplastic lymphoma kinase-driven neuroblastoma model

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448453_at (ID_REF), GDS4621, 15492 (Gene ID), NM_008293

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 101302953

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 940259532.

Hsd3b1 - Gonadal development: ovaries and testes

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448453_at (ID_REF), GDS4503, 15492 (Gene ID), NM_008293

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 94025953

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 827377533.

Hsd3b1 - Neonatal ovarian xenobiotic cultures

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448453_at (ID_REF), GDS4171, 15492 (Gene ID), NM_008293

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 82737753

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 748407534.

Hsd3b1 - Chronic cardiac pressure overload effect on adrenal medulla

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448453_at (ID_REF), GDS3978, 15492 (Gene ID), NM_008293

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 74840753

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 716828275.

Hsd3b1 - Fasting effect on multiple tissues: time course

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL11012, 17327 (ID_REF), GDS3893, NM_008293

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71682827

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 677522016.

Hsd3b1 - Chromogranin A-null model of hypertension: adrenal gland

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL81, 103072_at (ID_REF), GDS3779, 15492 (Gene ID), M58567

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 67752201

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 677393017.

Hsd3b1 - BPH model of hypertension: adrenal gland

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL81, 103072_at (ID_REF), GDS3777, 15492 (Gene ID), M58567

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 67739301

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 565148538.

Hsd3b1 - Activin deficiency effect on ovarian granulosa cells

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448453_at (ID_REF), GDS3422, 15492 (Gene ID), NM_008293

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 56514853

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 551489659.

Hsd3b1 - Ovaries from a high-fertility line

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL339, 1448453_at (ID_REF), GDS3368, 15492 (Gene ID), NM_008293

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 55148965

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4988675310.

Hsd3b1 - Various tissues

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448453_at (ID_REF), GDS3142, 15492 (Gene ID), NM_008293

DataSet type:: Expression profiling by array, count, 70 samples

ID:: 49886753

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3874835311.

Hsd3b1 - Embryonic gonad development

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448453_at (ID_REF), GDS2719, 15492 (Gene ID), NM_008293

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 38748353

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3007326512.

Hsd3b1 - Antenatal steroid effect on the placenta

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL339, 1448453_at (ID_REF), GDS2314, 15492 (Gene ID), NM_008293

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30073265

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2867485313.

Hsd3b1 - Circadian clock deficient Per2/Cry1 double mutant adrenal gland in constant darkness: time course

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448453_at (ID_REF), GDS2233, 15492 (Gene ID), NM_008293

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 28674853

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2666155314.

Hsd3b1 - BRG1 maternally depleted embryos

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448453_at (ID_REF), GDS2156, 15492 (Gene ID), NM_008293

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 26661553

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2553875315.

Hsd3b1 - Testis development

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448453_at (ID_REF), GDS2098, 15492 (Gene ID), NM_008293

DataSet type:: Expression profiling by array, count, 21 samples

ID:: 25538753

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 747858916.

Hsd3b1 - MPSS transcriptome analysis project

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGGGCTATGAGCCACT (ID_REF), GDS868, NM_008293

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7478589

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 436916517.

Hsd3b1 - Sex specific transcription in somatic and reproductive tissues

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL339, 1448453_at (ID_REF), GDS565, 15492 (Gene ID), NM_008293

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 4369165

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 27639318.

Hsd3b1 - Granulosa cell tumorigenesis (Mu11K-A)

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL75, M58567_s_at (ID_REF), GDS47, 15492 (Gene ID), M58567

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 276393

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7219845319.

Hsd3b1 - Polyubiquitin knockout effect on testis: time course

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448453_at (ID_REF), GDS3906, 15492 (Gene ID), NM_008293

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 72198453

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5618175320.

Hsd3b1 - Low doses of perfluorooctanoic acid effect on fetal liver and lung

Annotation:: Hsd3b1, hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1448453_at (ID_REF), GDS3411, 15492 (Gene ID), NM_008293

DataSet type:: Expression profiling by array, transformed count, 29 samples

ID:: 56181753

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 89

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 15492) (1762)
GEO Profiles
Alveolar macrophage response to bacterial endotoxin lipopolysaccharide exposure ...
Alveolar macrophage response to bacterial endotoxin lipopolysaccharide exposure in vivo
Accession: GDS4419

GEO DataSets
Related DataSets for GEO Profiles (Select 89426262) (1)
GEO DataSets

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1762

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity