GEO Profile Links for Gene (Select 12291) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1730

<< First< Prev

Page of 87

Next >Last >>

Select item 201707711.

Cacna1g - Age effect on hematopoietic stem cells

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1423365_at (ID_REF), GDS1803, 12291 (Gene ID), AW494038

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 20170771

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1316382002.

Cacna1g - Normal liver developmental stages: embryonic and postnatal

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P466910 (ID_REF), GDS5818, NM_009783, A_51_P466910 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131638200

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 279550043.

Cacna1g - Estradiol effect on the uterus: time course

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL891, 604 (ID_REF), GDS2208, NM_009783, A_51_P466910 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 27955004

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 249227044.

Cacna1g - Estren effect on the uterus: time course

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL891, 604 (ID_REF), GDS2077, NM_009783, A_51_P466910 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 12 samples

ID:: 24922704

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 130078045.

Cacna1g - Conjugated linoleic acid delipidative effect on obese line: time course

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL891, 604 (ID_REF), GDS1360, NM_009783, A_51_P466910 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13007804

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 980578716.

Cacna1g - HdhQ111 knock-in model of Huntington's disease: striatum and cerebellum

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1423365_at (ID_REF), GDS4534, 12291 (Gene ID), AW494038

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 98057871

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 732433717.

Cacna1g - Huntington's disease CAG knock-in effect on striatum and cerebellum

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1423365_at (ID_REF), GDS3935, 12291 (Gene ID), AW494038

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 73243371

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 728349008.

Cacna1g - Spatial and temporal development of mammalian salivary glands

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P466910 (ID_REF), GDS3922, NM_009783, A_51_P466910 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72834900

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1276054869.

Cacna1g - Progranulin deficiency effect on various brain regions: time course

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1241838 (ID_REF), GDS5501, NM_009783

DataSet type:: Expression profiling by array, transformed count, 99 samples

ID:: 127605486

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12705990710.

Cacna1g - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL4134, 26707 (ID_REF), GDS5461, NM_009783, A_51_P466910 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127059907

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8079987111.

Cacna1g - Alpha-synuclein deficiency effect on striatum and cerebellum: time course

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1423365_at (ID_REF), GDS4153, 12291 (Gene ID), AW494038

DataSet type:: Expression profiling by array, transformed count, 26 samples

ID:: 80799871

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2798537112.

Cacna1g - Spinal cord and dorsal root ganglion

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1423365_at (ID_REF), GDS2209, 12291 (Gene ID), AW494038

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 27985371

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 750612313.

Cacna1g - MPSS transcriptome analysis project

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTAGCTCCGCCTCCTG (ID_REF), GDS868, BC057399

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7506123

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12156857114.

Cacna1g - Antidepressant fluoxetine effect on depression model: dorsal dentate gyrus

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1423365_at (ID_REF), GDS5307, 12291 (Gene ID), AW494038

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 121568571

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7260247115.

Cacna1g - Various central nervous system regions of adult inbred strain

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1423365_at (ID_REF), GDS3917, 12291 (Gene ID), AW494038

DataSet type:: Expression profiling by array, transformed count, 102 samples

ID:: 72602471

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12161507116.

Cacna1g - Antidepressant fluoxetine effect on depression model: ventral dentate gyrus

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1423365_at (ID_REF), GDS5308, 12291 (Gene ID), AW494038

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 121615071

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10668236017.

Cacna1g - SIRT1 deficiency effect on the brain

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL8321, 1423365_at (ID_REF), GDS4895, 12291 (Gene ID), AW494038

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 106682360

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1926286018.

Cacna1g - CAG repeat knock-in model of spinocerebellar ataxia type 1 progression

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL339, 1423365_at (ID_REF), GDS1756, 12291 (Gene ID), AW494038

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 19262860

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6159029219.

Cacna1g - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1241838 (ID_REF), GDS3582, NM_009783, CACNA1G (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61590292

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3604607120.

Cacna1g - miRNA-1-2 knockout effect on the heart

Annotation:: Cacna1g, calcium channel, voltage-dependent, T type, alpha 1G subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1423365_at (ID_REF), GDS2614, 12291 (Gene ID), AW494038

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 36046071

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 87

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 12291) (1730)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1730

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity