GEO Profile Links for Gene (Select 11553) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 3520

<< First< Prev

Page of 176

Next >Last >>

Select item 553903891.

Adra2c - Heart failure progression model: non-infarcted ventricular tissue

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL891, 14689 (ID_REF), GDS3386, NM_007418, A_51_P398633 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 55390389

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 172021412.

Adra2c - RPE65 null mutant model of Leber's congenital amaurosis

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL1261, 1422335_at (ID_REF), GDS1647, 11553 (Gene ID), NM_007418

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 17202141

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1092353423.

Adra2c - Diabetic db/db heart response to rosiglitazone

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL4134, 25442 (ID_REF), GDS4990, NM_007418, A_52_P428345 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109235342

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 625640714.

Adra2c - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL6333, scl27902.1_282-S (ID_REF), GDS3621, NM_007418, Adra2c (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62564071

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 732553025.

Adra2c - Huntington's disease CAG knock-in effect on striatum and cerebellum

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL1261, 1435296_at (ID_REF), GDS3935, 11553 (Gene ID), AV349563

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 73255302

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 706147026.

Adra2c - Embryonic development of male reproductive tract tissues

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL1261, 1435296_at (ID_REF), GDS3862, 11553 (Gene ID), AV349563

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 70614702

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 980698027.

Adra2c - HdhQ111 knock-in model of Huntington's disease: striatum and cerebellum

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL1261, 1435296_at (ID_REF), GDS4534, 11553 (Gene ID), AV349563

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 98069802

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 890425238.

Adra2c - Nitric oxide generator DETA-NONOate effect on in vitro neuronal injury model: time course

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL1261, 1457328_at (ID_REF), GDS4408, 11553 (Gene ID), BE957015

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 89042523

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 354881029.

Adra2c - Regenerating liver and developing embryonic liver comparison

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL1261, 1435296_at (ID_REF), GDS2577, 11553 (Gene ID), AV349563

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 35488102

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1721510210.

Adra2c - RPE65 null mutant model of Leber's congenital amaurosis

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL1261, 1435296_at (ID_REF), GDS1647, 11553 (Gene ID), AV349563

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 17215102

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2801932311.

Adra2c - Spinal cord and dorsal root ganglion

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL1261, 1457328_at (ID_REF), GDS2209, 11553 (Gene ID), BE957015

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 28019323

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7568567012.

Adra2c - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL6481, 5130154 (ID_REF), GDS4002, NM_007418, Adra2c (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75685670

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5730412313.

Adra2c - Murine model of primary mitochondrial dysfunction

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL1261, 1457328_at (ID_REF), GDS3454, 11553 (Gene ID), BE957015

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 57304123

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 93254714.

Adra2c - Progesterone and Hoxa-10 relationship

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL81, 99804_at (ID_REF), GDS187, 11553 (Gene ID), M97516

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 932547

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4204654115.

Adra2c - DNA electroporation effect on skeletal muscles: time course

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL1261, 1422335_at (ID_REF), GDS2840, 11553 (Gene ID), NM_007418

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 42046541

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12247340216.

Adra2c - Heat shock protein 90 inhibitor effect on Huntington’s disease model: brain striatum

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL1261, 1435296_at (ID_REF), GDS5337, 11553 (Gene ID), AV349563

DataSet type:: Expression profiling by array, transformed count, 32 samples

ID:: 122473402

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11260640217.

Adra2c - Atypical neuroleptic quetiapine effect on brain: dose response

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL1261, 1435296_at (ID_REF), GDS4623, 11553 (Gene ID), AV349563

DataSet type:: Expression profiling by array, transformed count, 20 samples

ID:: 112606402

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 751128318.

Adra2c - MPSS transcriptome analysis project

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAGTTCCTGAGAAGGC (ID_REF), GDS868, BE994823

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7511283

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12246044119.

Adra2c - Heat shock protein 90 inhibitor effect on Huntington’s disease model: brain striatum

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL1261, 1422335_at (ID_REF), GDS5337, 11553 (Gene ID), NM_007418

DataSet type:: Expression profiling by array, transformed count, 32 samples

ID:: 122460441

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10018924120.

Adra2c - Microchimeric fetal cells isolated from maternal lung during late pregnancy

Annotation:: Adra2c, adrenergic receptor, alpha 2c

Organism:: Mus musculus

Reporter:: GPL1261, 1422335_at (ID_REF), GDS4591, 11553 (Gene ID), NM_007418

DataSet type:: Expression profiling by array, transformed count, 7 samples

ID:: 100189241

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 176

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 11553) (3520)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 3520

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity