GEO Profile Links for Gene (Select 107338) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 4506

<< First< Prev

Page of 226

Next >Last >>

Select item 39199161.

Gbf1 - Intestinal tract gene expression (MG-U74B)

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL82, 165206_r_at (ID_REF), GDS522, 107338 (Gene ID), AV331542

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 3919916

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 922766402.

Gbf1 - Rough attenuated Brucella suis strain infection effect on macrophage cell line: time course

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415709_s_at (ID_REF), GDS4432, 107338 (Gene ID), BM948896

DataSet type:: Expression profiling by array, count, 42 samples

ID:: 92276640

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 215656533.

Gbf1 - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL1942, 15653 (ID_REF), GDS1882, BC011335

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21565653

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1193862274.

Gbf1 - Chronic, low level drug exposure effect on obese liver

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P144712 (ID_REF), GDS5258, NM_178930, A_51_P144712 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119386227

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 866960135.

Gbf1 - All-trans retinoic acid effect on retinoic acid receptor α-deficient F9 teratocarcinoma cells

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL1261, 1438207_at (ID_REF), GDS4294, 107338 (Gene ID), BB744704

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 86696013

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 619267136.

Gbf1 - p300 genetic reduction model of Rubinstein-Taybi syndrome: hippocampus

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL1261, 1438207_at (ID_REF), GDS3598, 107338 (Gene ID), BB744704

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61926713

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 572625887.

Gbf1 - Murine model of primary mitochondrial dysfunction

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415757_at (ID_REF), GDS3454, 107338 (Gene ID), BM948896

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 57262588

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1122219138.

Gbf1 - Cystatin B knockout model of progressive myoclonus epilepsy: postnatal day 7 cerebellum

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL1261, 1438207_at (ID_REF), GDS5089, 107338 (Gene ID), BB744704

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 112221913

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 922766889.

Gbf1 - Rough attenuated Brucella suis strain infection effect on macrophage cell line: time course

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415757_at (ID_REF), GDS4432, 107338 (Gene ID), BM948896

DataSet type:: Expression profiling by array, count, 42 samples

ID:: 92276688

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3534181710.

Gbf1 - Bone morphogenic protein 6 effect on an endothelial cell line: time course

Annotation:: Gbf1, Golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL922, 19617 (ID_REF), GDS2571, K0302B03 (CLONE ID), A_65_P05443 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 12 samples

ID:: 35341817

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2652614011.

Gbf1 - RNA helicase p68/p72 knockdown effect on skeletal muscle cells (MG-430B)

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL340, 1415709_s_at (ID_REF), GDS2152, 107338 (Gene ID), BM948896

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 26526140

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3753548812.

Gbf1 - Embryonic J1 stem cell differentiation in vitro (MG-430B)

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL340, 1415757_at (ID_REF), GDS2669, 107338 (Gene ID), BM948896

DataSet type:: Expression profiling by array, count, 33 samples

ID:: 37535488

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3700068813.

Gbf1 - Asthma model: lungs

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415757_at (ID_REF), GDS2647, 107338 (Gene ID), BM948896

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 37000688

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2652618814.

Gbf1 - RNA helicase p68/p72 knockdown effect on skeletal muscle cells (MG-430B)

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL340, 1415757_at (ID_REF), GDS2152, 107338 (Gene ID), BM948896

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 26526188

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2339538815.

Gbf1 - Lymphotoxin-beta receptor signaling inhibition effect on lymph nodes: time course (MG-430B)

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL340, 1415757_at (ID_REF), GDS2005, 107338 (Gene ID), BM948896

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 23395388

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 446537016.

Gbf1 - Preimplantation development

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL870, 19570 (ID_REF), GDS578, AK039570, AK041959, AK172919, BC004807, BC011335, BC023791, BC024129, BC026621, BC034745, BC059883, L0281D01-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4465370

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5693738817.

Gbf1 - Vancomycin effect on the kidney: dose response

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415757_at (ID_REF), GDS3435, 107338 (Gene ID), BM948896

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 56937388

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1509478918.

Gbf1 - Mechanical stimulation effect on fibroblasts from various fetal tissues (MG-430B)

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL340, 1438207_at (ID_REF), GDS1501, 107338 (Gene ID), BB744704

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 15094789

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 747197619.

Gbf1 - MPSS transcriptome analysis project

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCACTCCAGGCTGCGAG (ID_REF), GDS868, NM_178930

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7471976

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 5539908820.

Gbf1 - Chromatin remodeling component BAF250a deficiency effect on embryonic stem cells in vitro

Annotation:: Gbf1, golgi-specific brefeldin A-resistance factor 1

Organism:: Mus musculus

Reporter:: GPL1261, 1415757_at (ID_REF), GDS3387, 107338 (Gene ID), BM948896

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 55399088

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 226

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 107338) (4506)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 4506

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity