^PLATFORM = Murine 15K long oligo array version 2.0 !Platform_title = Murine 15K long oligo array version 2.0 !Platform_technology = spotted oligonucleotide !Platform_distribution = non-commercial !Platform_organism = Mus musculus !Platform_manufacturer = Un. London microarray facility !Platform_manufacture_protocol = 1. Oligos are arrayed in Greiner 384-well flat-bottom plates. Each well contains 600 pmol of 70-mer oligo. !Platform_manufacture_protocol = 2. Resuspend oligos in water to 20 uM and rearray 5 µL into 384-well, Genetix polystyrene V-bottom plates (cat# X6004). !Platform_manufacture_protocol = 3. Allow Genetix plates to dry through passive water evaporation in a protected environment (e.g., chemical hood). !Platform_manufacture_protocol = 4. Before printing, add 5 µL of 1X Printing Buffer to each well. This can be done the night before a print run is started. !Platform_manufacture_protocol = 5. Seal plates with Corning seals. !Platform_manufacture_protocol = 6. Incubate at 37°C for 30 minutes to aid resuspension of DNA. !Platform_manufacture_protocol = 7. Shake plates near maximum rotational speed on flat-bed shaker for 1 minute. !Platform_manufacture_protocol = 8. Centrifuge plates at 2000 rpm for 3 minutes. !Platform_manufacture_protocol = 9. Remove seals and cover with plate lids. Place in appropriate location of plate cassette. This should be done with first plates just before print run is started to minimize evaporation time before printing. For second and third cassettes, wait until 30 minutes before next cassette is needed to begin centrifugation. !Platform_manufacture_protocol = 10. Make sure plates rest behind both holding clips in the cassettes. Push plates back into the cassettes as far as they will go, putting them in the proper position for the server arm. !Platform_manufacture_protocol = 11. After the print run is completed, allow plates to dry through passive evaporation in a protected environment.!Platform_manufacture_protocol = 12. For each subsequent preparation of these plates for a print run, add water to the wells instead of sodium phosphate buffer. The amount of water should be decreased by 0.25 µL per print run, as this is the amount drawn up by the pin capillary during each dip. !Platform_support = glass !Platform_coating = polysine !Platform_web_link = http://www.microarray.protocols.html !Platform_contributor = Jane,Doe !Platform_contributor = John,A,Smith !Platform_contributor = Hans,van Elton !Platform_contributor = John,Smithers Jr !Platform_contributor = Jie,D,Chen #ID = #GB_ACC = GenBank accession number of sequence used to design oligonucleotide probe LINK_PRE:"https://0-www-ncbi-nlm-nih-gov.brum.beds.ac.uk/nucleotide/" #Gene_Desc = Gene description #Gene_Sym = Gene symbols #SEQUENCE = Probe sequence information #SPOT_ID = alternative identifier !platform_table_begin ID GB_ACC Gene_Desc Gene_Sym SPOT_ID SEQUENCE 1 U02079 nuclear factor of activated T-cells, cytoplasmic 2 Nfatc2ACCTGGATGACGCAGCCACTTCAGAAAGCTGGGTTGGGACAGAAAGGTATATAGAGAGAAAATTTTGGAA 2 NM_008154 G-protein coupled receptor 3 Gpr3CTGTACAATGCTCTCACTTACTACTCAGAGACAACGGTAACTCGGACTTATGTGATGCTGGCCTTGGTGT 3 AK015719 tropomodulin 2 Tmod2CACCAGGCTCAGTGCCTAGTATCGGCTTCACCTAGTGTGGTTACTCAGGGCACGCAGAGCTACAGAACAC 4 AK003367 mitochondrial ribosomal protein L15 Mrpl15CAAGAAGTCTAGAAATTCTGTGCAAGCCTATTCCATTCTTTCTGCGGGGACAACCAATTCCGAAAAGAAT 5 BC003333 RIKEN cDNA 0610033I05 gene 0610033I05RikAGAACTGGGTGGCAGATATCCTAGAGTTTTGACCAACGTTCACAGCACACATATTGATCTTATAGGACCT 6 NM_008462 killer cell lectin-like receptor, subfamily A, member 2 Klra2TGAATTGAAGTTCCTTAAATCCCAACTTCAAAGAAACACATACTGGATTTCACTGACACATCATAAAAGC 7 NM_008029 FMS-like tyrosine kinase 4 Flt4GAGGTGCTGTGGGATGACCGCCGGGGCATGCGGGTGCCCACTCAACTGTTGCGCGATGCCCTGTACCTGC 8 NM_054088 adiponutrin AdpnGTCTGAGTTCCATTCCAAAGACGAAGTCGTGGATGCCCTGGTGTGTTCCTGCTTCATTCCCCTCTTCTCT 9 NM_009750 nerve growth factor receptor (TNFRSF16) associated protein 1 Ngfrap1TACAGCTGAGAAATTGTCTACGCATCCTTATGGGGGAGCTGTCTAACCACCACGATCACCATGATGAATT 10 AB045323 DNA segment, Chr 8, ERATO Doi 594, expressed D8Ertd594eGATTCAGACTCGGGAGGAGCATCCCAACCTCTCCTTGAGGATAAAGGCCTGAGCGATTGCCCTGGGGAGC 11 AK005789 dynein, cytoplasmic, light chain 2B Dncl2bTGCAGAAGGCATTCCAATCCGAACAACCCTGGACAACTCCACAACGGTTCAGTATGCGGGTCTTCTCCAC 12 NM_010517 insulin-like growth factor binding protein 4 Igfbp4GGAGAAGCTGGCGCGCTGCCGCCCCCCCGTGGGTTGCGAGGAGTTGGTGCGGGAGCCAGGCTGCGGTTGT 13 AK010722 RIKEN cDNA 2410075D05 gene 2410075D05RikGGAGCATCTGGAGTTCCGCTTACCGGAAATAAAGTCTTTACTATCGGTGATTGGAGGGCAGTTCACTAAC 14 AK003755 DNA segment, Chr 4, ERATO Doi 421, expressed D4Ertd421eAGCAAAGAGATCTCCCTCAGTGTGCCCATAGGTGGCGGTGCGAGCTTGCGGTTATTGGCCAGTGACTTGC 15 BC003241 cleavage stimulation factor, 3' pre-RNA, subunit 3 Cstf3AAATTAGAAGAAAATCCATATGACCTTGATGCTTGGAGCATTCTCATTCGAGAGGCACAGAATCAACCTA 16 AK004937 RIKEN cDNA 1300007O09 gene 1300007O09RikCAGACACAAACCCTAGGTTGTATTGTAGACCGGAGTTTAAGCAGGCACTACCTGTCTGTCTTTTCTTCAT 17 AK004524 unnamed protein product; hypothetical SOCS domain CGGAGCCCTGCGCGCCCAGAGCCCCCTCCCACCCGCTTCCACCAAGTGCATGGAGCCAACATCCGCATGG 18 NM_025999 RIKEN cDNA 2610110L04 gene 2610110L04RikTGCATTGATAAATGGAGTGATCGACACAGGAACTGCCCCATTTGTCGCCTACAGATGACTGGAGCAAATG 19 --CONTROL 20 NM_023120 guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gnb1lACCGCCTGGTCCCAGATTTGTCCTCCGAGGCACACAGTCGGCTGTGAACACGCTCCATTTCTGCCCACCA !platform_table_end