nsv5674265
- Organism: Homo sapiens
- Study:nstd102 (Clinical Structural Variants)
- Variant Type:insertion
- Method Type:Multiple
- Submitted on:GRCh37, GRCh38
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: Yes
- Region Size:1
- Description:NM_000465.4(BARD1):c.1776_1777insTTTTTTTTTTTTT
TTTTTTGNNNNNNNNNNCTCGATCTCCTGACCTCGTGATCCGCCCGCCTCGGCCTCCC
AAAGTGCTGGGATTACAGGCGTGAGCCACCGCGCCCGGCCCGCAGTAATTCTT (p.Lys593delinsPhePhePhePhePhePheXaaXaaXaaXaaLeuAspLeuLeuThrSerTer) AND Familial cancer of breast - Publication(s):Berliner et al. 2007, Burstein et al. 2021, Miller et al. 2021, Miller et al. 2022, Moyer et al. 2014, Nelson et al. 2013, Nelson et al. 2019, No authors et al. 2014, No authors et al. 2021, No authors et al. 2021, Petrucelli et al. 1998, Stratton et al. 2008, Trepanier et al. 2004, US Preventive Services Task Force et al. 2019
- ClinVar: RCV001380298.4
- ClinVar: VCV001068665.4
- GeneReviews: NBK1247
- MONDO: 0016419
- MedGen: C0346153
- OMIM: 114480
- PubMed: 15604628
- PubMed: 17508274
- PubMed: 18163131
- PubMed: 20301425
- PubMed: 24366376
- PubMed: 24366402
- PubMed: 24432435
- PubMed: 26389210
- PubMed: 26389258
- PubMed: 31429903
- PubMed: 31479213
- PubMed: 34012068
- PubMed: 34242744
- PubMed: 35802134
- Overlapping Genes
Source: NCBI
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 79 SVs from 18 studies. See in: genome view
Overlapping variant regions from other studies: 79 SVs from 18 studies. See in: genome view
Variant Region Placement Information
| Variant Region ID | Placement Type | Assembly | Assembly Unit | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nsv5674265 | Submitted genomic | GRCh38 (hg38) | Primary Assembly | NC_000002.12 | Chr2 | 214,745,755 | 214,745,755 |
| nsv5674265 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000002.11 | Chr2 | 215,610,479 | 215,610,479 |
Variant Call Information
| Variant Call ID | Type | Method | Analysis | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv17172396 | insertion | Multiple | Multiple | BRCA1- and BRCA2-Associated Hereditary Breast and Ovarian Cancer; BREAST CANCER; Familial cancer of breast | Pathogenic | ClinVar | RCV001380298.4, VCV001068665.4 |
Variant Call Placement Information
| Variant Call ID | Placement Type | HGVS | Assembly | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nssv17172396 | Submitted genomic | NC_000002.12:g.214 745755_214745756in s124 | GRCh38 (hg38) | NC_000002.12 | Chr2 | 214,745,755 | 214,745,755 |
| nssv17172396 | Submitted genomic | NC_000002.11:g.215 610479_215610480in s124 | GRCh37 (hg19) | NC_000002.11 | Chr2 | 215,610,479 | 215,610,479 |
No validation data were submitted for this variant
Clinical Assertions
| Variant Call ID | HGVS | Type | Allele Origin | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv17172396 | GRCh37: NC_000002.11:g.215610479_215610480ins124, GRCh38: NC_000002.12:g.214745755_214745756ins124 | insertion | germline | BRCA1- and BRCA2-Associated Hereditary Breast and Ovarian Cancer; BREAST CANCER; Familial cancer of breast | Pathogenic | ClinVar | RCV001380298.4, VCV001068665.4 |