ClinVar Genomic variation as it relates to human health
G6PD NARA
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Pathogenic(1); Likely pathogenic(4); Uncertain significance(1)
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
G6PD NARA
Variation ID: 10411 Accession: VCV000010411.20
- Type and length
-
Deletion, 24 bp
- Location
-
Cytogenetic: Xq28 X: 154533013-154533036 (GRCh38) [ NCBI UCSC ] X: 153761228-153761251 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Aug 22, 2016 Feb 20, 2024 May 1, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_001360016.2:c.957_980del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_001346945.1:p.Lys320_Thr327del inframe deletion NM_000402.4:c.1047_1070del NP_000393.4:p.Lys350_Thr357del inframe deletion NM_001042351.1:c.953_976delCCACCAAAGGGTACCTGGACGACC NM_001042351.2:c.957_980del24 NM_001042351.3:c.957_980del NP_001035810.1:p.Lys320_Thr327del inframe deletion NC_000023.11:g.154533017_154533040del NC_000023.10:g.153761232_153761255del NG_009015.2:g.19537_19560del - Protein change
- Other names
- G6PD, 24-BP DEL, NT953
- G6PD Nara
- Canonical SPDI
- NC_000023.11:154533012:GTGGGGTCGTCCAGGTACCCTTTGGTGG:GTGG
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Comment on variant
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
G6PD | - | - |
GRCh38 GRCh37 |
636 | 948 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Conflicting interpretations of pathogenicity (5) |
criteria provided, conflicting classifications
|
May 1, 2023 | RCV000143789.22 | |
Likely pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
Dec 29, 2020 | RCV001509137.17 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Likely pathogenic
(Dec 29, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Not provided
Affected status: unknown
Allele origin:
germline
|
Mayo Clinic Laboratories, Mayo Clinic
Accession: SCV001715684.1
First in ClinVar: Jun 15, 2021 Last updated: Jun 15, 2021 |
Comment:
PM2, PM4, PP4, PS4_supporting
Number of individuals with the variant: 1
|
|
Likely pathogenic
(May 31, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Anemia, nonspherocytic hemolytic, due to G6PD deficiency
Affected status: unknown
Allele origin:
germline
|
Revvity Omics, Revvity
Accession: SCV003833832.2
First in ClinVar: Mar 04, 2023 Last updated: Feb 04, 2024 |
|
|
Likely pathogenic
(Sep 19, 2019)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories
Accession: SCV001473440.1
First in ClinVar: Jan 26, 2021 Last updated: Jan 26, 2021 |
Comment:
The G6PD c.957_980del; p.Lys320_Thr327del variant (rs587776730), also known as G6PD Nara, is reported in the literature in an individual affected with G6PD deficiency (Hirono 1993). … (more)
The G6PD c.957_980del; p.Lys320_Thr327del variant (rs587776730), also known as G6PD Nara, is reported in the literature in an individual affected with G6PD deficiency (Hirono 1993). This variant deletes eight amino acids, leaving the rest of the protein in-frame. Functional analysis of hemolysate from an affected individual with this variant showed no detectable G6PD activity, and the variant protein was reported to be extremely thermolabile with rapid loss of residual enzyme activity (Hirono 1993). This variant is absent from general population databases (Exome Variant Server, Genome Aggregation Database), indicating it is not a common polymorphism. Based on available information, this variant is considered to be likely pathogenic. References: Hirono A et al. G6PD Nara: a new class 1 glucose-6-phosphate dehydrogenase variant with an eight amino acid deletion. Blood. 1993 Dec 1;82(11):3250-2. (less)
|
|
Likely pathogenic
(Feb 21, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Anemia, nonspherocytic hemolytic, due to G6PD deficiency
Affected status: unknown
Allele origin:
germline
|
Johns Hopkins Genomics, Johns Hopkins University
Accession: SCV002570289.1
First in ClinVar: Sep 17, 2022 Last updated: Sep 17, 2022 |
Comment:
This G6PD variant (rs587776730) is absent from a large population dataset and has been reported to ClinVar. This Class I variant, sometimes referred to as … (more)
This G6PD variant (rs587776730) is absent from a large population dataset and has been reported to ClinVar. This Class I variant, sometimes referred to as "G6PD Nara", has been identified in three unrelated males with chronic-hemolytic anemia. This 24-bp deletion in exon 9 of the G6PD gene removes eight amino acids, leaving the rest of the protein in-frame. No measurable G6PD activity was detected in the hemolysate of a patient with this variant, and the partially purified protein was reported to be extremely thermolabile with rapid loss of activity. This variant was also identified in the patient's asymptomatic mother (JHG1850-2). Based on the available evidence, we consider this variant to be likely pathogenic. (less)
|
|
Pathogenic
(Aug 12, 2022)
|
criteria provided, single submitter
Method: curation
|
Anemia, nonspherocytic hemolytic, due to G6PD deficiency
Affected status: yes
Allele origin:
unknown
|
Dunham Lab, University of Washington
Accession: SCV002599351.1
First in ClinVar: Nov 13, 2022 Last updated: Nov 13, 2022 |
Comment:
Variant found in unrelated hemizygotes with deficiency and CNSHA (PS4_M, PP4). No detectable activity in red blood cells (PS3). Leads to deletion of eight amino … (more)
Variant found in unrelated hemizygotes with deficiency and CNSHA (PS4_M, PP4). No detectable activity in red blood cells (PS3). Leads to deletion of eight amino acids (PM4). Not found in gnomAD (PM2). Post_P 0.997 (odds of pathogenicity 3158, Prior_P 0.1). (less)
|
|
Uncertain significance
(May 01, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Anemia, nonspherocytic hemolytic, due to G6PD deficiency
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV003496308.2
First in ClinVar: Feb 07, 2023 Last updated: Feb 20, 2024 |
Comment:
This variant has been observed in individual(s) with G6PD deficiency (PMID: 8241497, 16753852; Invitae). In summary, the available evidence is currently insufficient to determine the … (more)
This variant has been observed in individual(s) with G6PD deficiency (PMID: 8241497, 16753852; Invitae). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant disrupts a region of the G6PD protein in which other variant(s) (p.Tyr322His) have been observed in individuals with G6PD-related conditions (PMID: 11112389). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. ClinVar contains an entry for this variant (Variation ID: 10411). This variant is not present in population databases (gnomAD no frequency). This variant, c.957_980del, results in the deletion of 8 amino acid(s) of the G6PD protein (p.Lys320_Thr327del), but otherwise preserves the integrity of the reading frame. (less)
|
|
Pathogenic
(Dec 01, 1993)
|
no assertion criteria provided
Method: literature only
|
ANEMIA, NONSPEHEROCYTIC HEMOLYTIC, DUE TO G6PD DEFICIENCY
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV000188683.3
First in ClinVar: Sep 08, 2014 Last updated: Aug 22, 2016 |
Comment on evidence:
In a Japanese boy with severe G6PD deficiency (300908), Hirono et al. (1993) identified a 24-bp deletion (nucleotides 953-976) in exon 9 of the G6PD … (more)
In a Japanese boy with severe G6PD deficiency (300908), Hirono et al. (1993) identified a 24-bp deletion (nucleotides 953-976) in exon 9 of the G6PD gene, which predicted an 8-amino acid deletion at residue 319. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for rasburicase therapy in the context of G6PD deficiency genotype. | Relling MV | Clinical pharmacology and therapeutics | 2014 | PMID: 24787449 |
Glucose-6-phosphate dehydrogenase (G6PD) mutations database: review of the "old" and update of the new mutations. | Minucci A | Blood cells, molecules & diseases | 2012 | PMID: 22293322 |
G6PD deficiency: the genotype-phenotype association. | Mason PJ | Blood reviews | 2007 | PMID: 17611006 |
G6PD deficiency with hemolytic anemia due to a rare gene deletion--a report of the first case in Malaysia. | Ainoon O | Hematology (Amsterdam, Netherlands) | 2006 | PMID: 16753852 |
A new exon 9 glucose-6-phosphate dehydrogenase mutation (G6PD "Rehovot") in a Jewish Ethiopian family with variable phenotypes. | Iancovici-Kidon M | Blood cells, molecules & diseases | 2000 | PMID: 11112389 |
Clinical and haematological consequences of recurrent G6PD mutations and a single new mutation causing chronic nonspherocytic haemolytic anaemia. | Vulliamy TJ | British journal of haematology | 1998 | PMID: 9674740 |
Glucose-6-phosphate dehydrogenase deficiency. | Mehta AB | Postgraduate medical journal | 1994 | PMID: 7870632 |
G6PD Nara: a new class 1 glucose-6-phosphate dehydrogenase variant with an eight amino acid deletion. | Hirono A | Blood | 1993 | PMID: 8241497 |
Human glucose-6-phosphate dehydrogenase variants. | Yoshida A | Bulletin of the World Health Organization | 1971 | PMID: 5316621 |
Text-mined citations for rs587776730 ...
HelpRecord last updated Jun 02, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.
NCBI staff reviewed the sequence information reported in PubMed 8241497 Fig. 1 to determine the location of this allele on the current reference sequence.