ClinVar Genomic variation as it relates to human health
NM_000308.4(CTSA):c.33GCT[7] (p.Leu19del)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000308.4(CTSA):c.33GCT[7] (p.Leu19del)
Variation ID: 195059 Accession: VCV000195059.31
- Type and length
-
Microsatellite, 3 bp
- Location
-
Cytogenetic: 20q13.12 20: 45891599-45891601 (GRCh38) [ NCBI UCSC ] 20: 44520238-44520240 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Jun 29, 2015 Apr 15, 2024 Feb 1, 2024 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000308.4:c.33GCT[7] MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000299.3:p.Leu19del inframe deletion NM_000308.4:c.54_56delGCT MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NM_000308.2:c.85_87delCTG NM_001127695.3:c.33GCT[7] NP_001121167.1:p.Leu19del inframe deletion NM_001167594.3:c.33GCT[7] NP_001161066.2:p.Leu19del inframe deletion NR_133656.2:n.78GCT[7] non-coding transcript variant NC_000020.11:g.45891601GCT[7] NC_000020.10:g.44520240GCT[7] NG_008291.1:g.5650GCT[7] NG_033108.1:g.4666CAG[7] - Protein change
- L19del
- Other names
- -
- Canonical SPDI
- NC_000020.11:45891598:CTGCTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCT
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
0.65027 (CTGCTGCTGCTGCTGCTGCTGCT)
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
CTSA | - | - |
GRCh38 GRCh37 |
520 | 555 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Benign (5) |
criteria provided, multiple submitters, no conflicts
|
Apr 6, 2023 | RCV000175578.13 | |
Benign (4) |
criteria provided, multiple submitters, no conflicts
|
Feb 1, 2024 | RCV000317016.15 | |
Benign (4) |
criteria provided, single submitter
|
Jun 13, 2018 | RCV000588925.11 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Benign
(Jun 14, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
Galactosialidosis
Affected status: unknown
Allele origin:
germline
|
Illumina Laboratory Services, Illumina
Accession: SCV000434076.2
First in ClinVar: Dec 06, 2016 Last updated: Dec 06, 2016 |
|
|
Benign
(Mar 28, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
germline
|
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Accession: SCV000538752.1
First in ClinVar: Jun 29, 2015 Last updated: Jun 29, 2015 |
Comment:
Variant identified in a genome or exome case(s) and assessed due to predicted null impact of the variant or pathogenic assertions in the literature or … (more)
Variant identified in a genome or exome case(s) and assessed due to predicted null impact of the variant or pathogenic assertions in the literature or databases. Disclaimer: This variant has not undergone full assessment. The following are preliminary notes: 64% of total chromosomes in ExAC (less)
Method: Genome/Exome Filtration
|
|
Benign
(Jul 30, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Combined deficiency of sialidase AND beta galactosidase
Affected status: no
Allele origin:
germline
|
Genome-Nilou Lab
Accession: SCV001876385.1
First in ClinVar: Sep 19, 2021 Last updated: Sep 19, 2021 |
Sex: mixed
|
|
Benign
(Apr 06, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV003928935.1
First in ClinVar: Jun 03, 2023 Last updated: Jun 03, 2023 |
|
|
Benign
(Feb 01, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Combined deficiency of sialidase AND beta galactosidase
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV001720817.4
First in ClinVar: Jun 15, 2021 Last updated: Feb 20, 2024 |
|
|
Benign
(May 04, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Combined deficiency of sialidase AND beta galactosidase
Affected status: no
Allele origin:
germline
|
Molecular Genetics, Royal Melbourne Hospital
Additional submitter:
Shariant Australia, Australian Genomics
Accession: SCV004812714.1
First in ClinVar: Apr 15, 2024 Last updated: Apr 15, 2024 |
Comment:
Latino/Admixed American population allele frequency is 68.93%% (rs781707830, 126967/203638 alleles, 37576 homozygotes in gnomAD v2.1). Based on the classification scheme RMH Modified ACMG/AMP Guidelines v1.1.0, … (more)
Latino/Admixed American population allele frequency is 68.93%% (rs781707830, 126967/203638 alleles, 37576 homozygotes in gnomAD v2.1). Based on the classification scheme RMH Modified ACMG/AMP Guidelines v1.1.0, this variant is classified as BENIGN. Following criteria are met: BA1 (less)
|
|
Benign
(May 19, 2015)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
germline
|
Eurofins Ntd Llc (ga)
Accession: SCV000227090.5
First in ClinVar: Jun 29, 2015 Last updated: Jun 29, 2015 |
Number of individuals with the variant: 1
Sex: mixed
|
|
Benign
(Jun 13, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV000985844.1
First in ClinVar: Aug 26, 2019 Last updated: Aug 26, 2019 |
Comment:
This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at … (more)
This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. (less)
|
|
Benign
(Mar 15, 2017)
|
no assertion criteria provided
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
unknown
|
Mayo Clinic Laboratories, Mayo Clinic
Accession: SCV000801182.1
First in ClinVar: Aug 05, 2018 Last updated: Aug 05, 2018 |
|
|
Benign
(-)
|
no assertion criteria provided
Method: clinical testing
|
not specified
Affected status: yes
Allele origin:
germline
|
Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center
Additional submitter:
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen
Study: VKGL Data-share Consensus
Accession: SCV001969982.1 First in ClinVar: Oct 07, 2021 Last updated: Oct 07, 2021 |
|
|
Benign
(-)
|
no assertion criteria provided
Method: clinical testing
|
not specified
Affected status: yes
Allele origin:
germline
|
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen
Study: VKGL Data-share Consensus
Accession: SCV001744124.3 First in ClinVar: Jul 07, 2021 Last updated: Sep 08, 2021 |
|
|
Likely benign
(-)
|
no assertion criteria provided
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
Laboratory of Diagnostic Genome Analysis, Leiden University Medical Center (LUMC)
Additional submitter:
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen
Study: VKGL Data-share Consensus
Accession: SCV001798606.2 First in ClinVar: Aug 21, 2021 Last updated: Dec 18, 2021 |
|
|
Benign
(Nov 22, 2017)
|
Flagged submission
flagged submission
Method: clinical testing
Reason: This record appears to be redundant with a more recent record from the same submitter.
Notes: SCV000696509 appears to be redundant with SCV003928935.
(less)
Notes: SCV000696509 appears to
(...more)
Source: NCBI
|
not provided
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV000696509.1
First in ClinVar: Mar 17, 2018 Last updated: Mar 17, 2018 |
Comment:
Variant summary: The CTSA c.108_110delGCT (p.Leu37del) variant involves the deletion of a luecine in a string of 9 leucines. One in silico tool predicts a … (more)
Variant summary: The CTSA c.108_110delGCT (p.Leu37del) variant involves the deletion of a luecine in a string of 9 leucines. One in silico tool predicts a polymorphism outcome for this variant. This variant was found in 144801/230752 control chromosomes (43432 homozygotes) at a frequency of 0.6275179, which is approximately 397 times the estimated maximal expected allele frequency of a pathogenic CTSA variant (0.0015811), suggesting this variant is likely a benign polymorphism. Taken together, this variant is classified as benign. One case report cites the variant in a GSL patient, along with two other variants that have not been reported by other clinical labs, therefore it is unclear which variants are disease-causing. Multiple clinical diagnostic laboratories/reputable databases classified this variant as benign. Taken together, this variant is classified as benign. (less)
|
|
click to load more click to collapse | |||||
Flagged submissions do not contribute to the aggregate classification or review status for the variant. Learn more |
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
A case of galactosialidosis with novel mutations of the protective protein/cathepsin a gene: diagnosis prompted by trophoblast vacuolization on placental examination. | Kostadinov S | Pediatric and developmental pathology : the official journal of the Society for Pediatric Pathology and the Paediatric Pathology Society | 2014 | PMID: 25075748 |
http://www.egl-eurofins.com/emvclass/emvclass.php?approved_symbol=CTSA | - | - | - | - |
Text-mined citations for rs72555383 ...
HelpRecord last updated Apr 15, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.